Report for Sequence Feature Glyma04g07230
Feature Type: gene_model
Chromosome: Gm04
Start: 5627722
stop: 5630930
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma04g07230
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G11270 AT
Annotation by Michelle Graham. TAIR10: overexpressor of cationic peroxidase 3 | chr5:3595557-3597076 REVERSE LENGTH=354
SoyBase E_val: 1.00E-68 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0006952 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response
SoyBase N/A ISS
GO:0009414 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to water deprivation
SoyBase N/A ISS
GO:0009737 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus
SoyBase N/A ISS
GO:0009867 GO-bp
Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway
SoyBase N/A ISS
GO:0010118 GO-bp
Annotation by Michelle Graham. GO Biological Process: stomatal movement
SoyBase N/A ISS
GO:0050832 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response to fungus
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
GO:0043565 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding
SoyBase N/A ISS
PF00046 PFAM
Homeobox domain
JGI ISS
UniRef100_C1MM68 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Ocp3-like homeobox transcription factor n=1 Tax=Micromonas pusilla CCMP1545 RepID=C1MM68_MICPC
SoyBase E_val: 2.00E-06 ISS
UniRef100_I1JUE1 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JUE1_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma04g07230
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma04g07230
Paralog Evidence Comments
Glyma06g07330 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma04g07230 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.04g068000 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma04g07230
Coding sequences of Glyma04g07230
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma04g07230.1 sequence type=CDS gene model=Glyma04g07230 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCTGTGGTTTTTCAGTGTTTATGGTGTGCTCGGAGTGACCCCTTCCTCACTCTTCCTTTCCAACGCAAACCACTTCTTTGCTCTGTCTTTCTTTCCTCTCGCCCTCGTAACCTCTGCTCTTCAATTGTCGCTGCTGCTTCCAAAAACAAAAACAAGCAAAAAAAGTCTCGTGATCATGTTACTAAGGACGATGAAGATGGCGTGGACGCTTTTGAGCTGCTCTTCAAGCAACTCGAAGAAGATCTCAAACGCGGTGATTTGTCAGACGATGATGGTGAGGATGAGATAAGTGAAGAAGACATGGCATTGCTTGAACGTGAGTTGGAAAATGCTTTGGGGGACTTTGATGGTGAATTGTTAAACTCGGATGTAATCGACATCGAAACTGGCGGTGATCCAGAAAATGATGATGATATTGAGGATGGTGGAGATGAAAGGTCACTGAACCTTAGGAATTGGCAGATGAAGAAATTGGCTAGAGCCTTAAAAGCTGGCCGCCGCAAAACAAGTATAAAAAATCTTGCTGCCGATCTTTGTCTTGATAGGGCTCTTGTTCTTCAATTGCTTCGTGACCCTCCTCCAAATCTTTTAATGATGAGTCTATCAATACCTGATGAACCCACAACGACTGTAGTATCACTTGAAACTAAGCCCAGTGAGATTGTTCATAAAGAAACAAGTATTGATCATGCAGAAATAGAATCTGAACCTAAGGCTAAAGTACCTGTTCATACCTTGCAACGTAATTGGCATGCTCAAAAGCGACTGAAAAAGGCCCATGTTGACACTTTGGAGAGAGTTTATAGGAGATCAAAACGACCCACTAATGCAATGATCAGTAGTATCGTACATGTAACAAACATTCCTCGAAAAAAAGTTGTTAAGTGGTTTGAAGACAAACGTGCTGAGGAGGGAGTTCCAGATCGCCGTGTTCCTTACCAGCGCTCTGTTCCTGAAACTGCATGA
Predicted protein sequences of Glyma04g07230
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma04g07230.1 sequence type=predicted peptide gene model=Glyma04g07230 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAVVFQCLWCARSDPFLTLPFQRKPLLCSVFLSSRPRNLCSSIVAAASKNKNKQKKSRDHVTKDDEDGVDAFELLFKQLEEDLKRGDLSDDDGEDEISEEDMALLERELENALGDFDGELLNSDVIDIETGGDPENDDDIEDGGDERSLNLRNWQMKKLARALKAGRRKTSIKNLAADLCLDRALVLQLLRDPPPNLLMMSLSIPDEPTTTVVSLETKPSEIVHKETSIDHAEIESEPKAKVPVHTLQRNWHAQKRLKKAHVDTLERVYRRSKRPTNAMISSIVHVTNIPRKKVVKWFEDKRAEEGVPDRRVPYQRSVPETA*