Glyma04g06365 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g06365

Feature Type:	gene_model
Chromosome:	Gm04
Start:	4867428
stop:	4870753
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g06365

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G10810	AT	Annotation by Michelle Graham. TAIR10: enhancer of rudimentary protein, putative \| chr5:3418897-3420556 REVERSE LENGTH=109	SoyBase	E_val: 8.00E-53	ISS
GO:0007049	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell cycle	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
KOG1766	KOG	Enhancer of rudimentary	JGI		ISS
PTHR12373	Panther	ENHANCER OF RUDIMENTARY ERH	JGI		ISS
PF01133	PFAM	Enhancer of rudimentary	JGI		ISS
UniRef100_I1MX63	UniRef	Annotation by Michelle Graham. Best UniRef hit: Enhancer of rudimentary homolog n=1 Tax=Glycine max RepID=I1MX63_SOYBN	SoyBase	E_val: 3.00E-62	ISS
UniRef100_I1MX63	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Enhancer of rudimentary homolog n=1 Tax=Glycine max RepID=I1MX63_SOYBN	SoyBase	E_val: 3.00E-62	ISS

Expression Patterns of Glyma04g06365

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g06365 not represented in the dataset	Glyma04g06365 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g06365

Paralog	Evidence	Comments
Glyma06g06411	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g06365 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma04g06365

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g06365

Limit To All Plant Sequences

>Glyma04g06365.1   sequence type=CDS   gene model=Glyma04g06365   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGCCTGTTCTGCGCATGCACCCCCTACAATCCCGCCTACCACCACTACCTCAACTTTGTCTCCGCTGCCACCGACGTTGTCGTCGCCTCCATCCACTGCCGCCTCGCCCCAGAAGACCCCCTCCTCGCTGCCTACGACGGCACTTGGGATGCCCTCCAGTGGACCGTTGCCCACTCCGCCGCCGTCGGCCCGGAGCCATGGCTCAACTCCCACGCCGATGGTCCATGTGGCAGTACTGGAGTGGGTGTTGGCGAATTGGAGTGTGGTACCTTGCGTAGTTGCAACGAAGGGAGTTGATCAAAATCGTATTCCTCTCCCTCACGCAAATCGCCACACAATTATTCTGATGCAGGCCTCTACGAACCGAGCAACTAGGACATTTATGGATTTTGAATCAATAACTCAGGCCATGGGTGGCATATGTGCATTGTATGAAAGGAAATTGAAGGAGTTAAATCCGACCATCAGAAATCTCTCTTATGATATCGTGGATCTCTACAACTTCATAGATGGTCTTGCAGACATGAGCGCATTAGTTTATGATCATTCAAGTCATGCTTACGTGCCACATGATCGACAGTGGATTAAGCAACGAACATTTCAACATTTGAAGAAACTGCTACGTTGA

Predicted protein sequences of Glyma04g06365

Limit To All Plant Sequences

>Glyma04g06365.1   sequence type=predicted peptide   gene model=Glyma04g06365   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAACSAHAPPTIPPTTTTSTLSPLPPTLSSPPSTAASPQKTPSSLPTTALGMPSSGPLPTPPPSARSHGSTPTPMVHVAVLEWVLANWSVVPCVVATKGVDQNRIPLPHANRHTIILMQASTNRATRTFMDFESITQAMGGICALYERKLKELNPTIRNLSYDIVDLYNFIDGLADMSALVYDHSSHAYVPHDRQWIKQRTFQHLKKLLR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain