SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g06240

Feature Type:gene_model
Chromosome:Gm04
Start:4774049
stop:4775966
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g06240
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G24930AT Annotation by Michelle Graham. TAIR10: CONSTANS-like 4 | chr5:8589325-8590949 FORWARD LENGTH=406 SoyBaseE_val: 3.00E-109ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0030003GO-bp Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0070838GO-bp Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG1601 KOG GATA-4/5/6 transcription factors JGI ISS
PF00643PFAM B-box zinc finger JGI ISS
PF06203PFAM CCT motif JGI ISS
UniRef100_G7JPB9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Constans n=1 Tax=Medicago truncatula RepID=G7JPB9_MEDTR SoyBaseE_val: 3.00E-132ISS
UniRef100_I1JU45UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JU45_SOYBN SoyBaseE_val: 0ISS

Proteins Associated with Glyma04g06240
LocusGene SymbolProtein Name
COL3a Constans-like 3a

Expression Patterns of Glyma04g06240
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g06240
ParalogEvidenceComments
Glyma06g06300 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g06240 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g058900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g06240
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g06240
>Glyma04g06240.1   sequence type=CDS   gene model=Glyma04g06240   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCCAAGCTCTGCGACTCATGCAAATCCGCCACTGCTACCTTGTACTGCCGCCCTGACGCCGCGTTCCTCTGCGGCGCCTGCGATTCTAAGGTCCACGCCGCCAACAAGCTCGCGTCGCGCCACCCGCGCGTGGCGCTCTGCGAGGTGTGCGAGCAGGCCCCGGCGCACGTAACCTGCAAGGCTGATGCCGCCGCGCTCTGCCTTGCCTGCGACCGCGACATCCACTCCGCCAACCCCCTCGCCAGCCGCCACGAGCGCATCCCCGTCTCACCGTTCTTCGAGTCCGTACACTCCGTCAAGGCCTCCTCGCCGATCAACTTCCTAGATGACCACCGCTTCTTCTCCGACGCCGATGCTGACGTCAGCACCGAGGAGGCCGAGGCCGCCTCCTGGCTGCTTCCTAATCCGAAGACAGATCTAAATTCCTCTCAGTACTTGTTCTCCGAAACCGAGCCGGTTCCTTACATAGATCTGGATTATGCTGCCGTGGATCCTAAGGCGGAGCAGAAAAGCTCCGCCACCGCCGACGGCGTCGTTCCCGTGCAGAGCAACTTCGAGCCATTCGCCTACGGTTACAAGTACAATACCACTCTCTCACAGTCTCAGATGAGCCAGAGTGTATCGTCGTCGTCGATGGAGGTTGGAGTCGTGCCGGACGGGAACACAATGTCGGAGACATCGAACTGCAGCTACAGCAAGGTGCCTCCGGTGACGGTGACGGTGACGGCGCAGTTCTCGGCGGCGGATAGGGAGGCGAGAGTGTTGAGGTACAGGGAGAAGAGGAAGAACCGTAAGTTCGAGAAGACGATTCGTTACGCATCGAGAAAAGCATATGCGGAGGCGAGGCCAAGGATCAAAGGGAGGTTTGCGAAACGCACTGACCCGGACCCTCTGGCTGGATACGGCGTCGTTCCGTCGTGTTGA
Predicted protein sequences of Glyma04g06240
>Glyma04g06240.1   sequence type=predicted peptide   gene model=Glyma04g06240   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASKLCDSCKSATATLYCRPDAAFLCGACDSKVHAANKLASRHPRVALCEVCEQAPAHVTCKADAAALCLACDRDIHSANPLASRHERIPVSPFFESVHSVKASSPINFLDDHRFFSDADADVSTEEAEAASWLLPNPKTDLNSSQYLFSETEPVPYIDLDYAAVDPKAEQKSSATADGVVPVQSNFEPFAYGYKYNTTLSQSQMSQSVSSSSMEVGVVPDGNTMSETSNCSYSKVPPVTVTVTAQFSAADREARVLRYREKRKNRKFEKTIRYASRKAYAEARPRIKGRFAKRTDPDPLAGYGVVPSC*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo