SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g05940

Feature Type:gene_model
Chromosome:Gm04
Start:4536395
stop:4537422
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g05940
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G21940AT Annotation by Michelle Graham. TAIR10: unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43850.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:7249446-7250353 REVERSE LENGTH=264 SoyBaseE_val: 3.00E-20ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
UniRef100_G7J8G5UniRef Annotation by Michelle Graham. Most informative UniRef hit: MTD1 n=1 Tax=Medicago truncatula RepID=G7J8G5_MEDTR SoyBaseE_val: 8.00E-47ISS
UniRef100_I1JU22UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JU22_SOYBN SoyBaseE_val: 1.00E-113ISS

Expression Patterns of Glyma04g05940
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g05940
ParalogEvidenceComments
Glyma06g05931 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g05940 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma04g05940
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g05940
>Glyma04g05940.2   sequence type=CDS   gene model=Glyma04g05940   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TGCGGTGAGAATGACAATGAGGCTCACAGTGCTTATAAATGTCTTGAACCTTTGGACACCATGGACTCTCTCCAACATCTTCTTCCCATCCGGGGCATCTCAAAGTTCTATGATGGCAAGTCCAAGTCATTCACGAGTCTGGTTGATGCTGGTTCTACCCCATATATCAAAGACATTGCAAAATCAGAGAATGCTTACACCAGCAGGGGTAGAAATTTGATGGCTTTCAATCACACATGGGAAAAGAGTCAAAGCTACCTTTTAAGAAGCAACAGTGGTGGCATTTCAAAGAAAACGACAATAAGCTCGAGCCGAAGTACCGTGGCTCTCGCTTTTGCAATCAACTATGAAAGCAGCAGTTGTTGTGCGAGCGAGGATTCATCTTTAAGCTCAAATCCGAGGTCACCTCCACCTCTTCCGCCACTCCATCCCCCAAGTACAGCTCCGTCCTCTCCTATGCAGCATAATTTCTCATCCCGGAGATACATCGCTACTCCCTGGACCCTGGGGAGTAAAGCAGCTCATCCATCACAGTAA
Predicted protein sequences of Glyma04g05940
>Glyma04g05940.2   sequence type=predicted peptide   gene model=Glyma04g05940   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CGENDNEAHSAYKCLEPLDTMDSLQHLLPIRGISKFYDGKSKSFTSLVDAGSTPYIKDIAKSENAYTSRGRNLMAFNHTWEKSQSYLLRSNSGGISKKTTISSSRSTVALAFAINYESSSCCASEDSSLSSNPRSPPPLPPLHPPSTAPSSPMQHNFSSRRYIATPWTLGSKAAHPSQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo