Report for Sequence Feature Glyma04g05480
Feature Type: gene_model
Chromosome: Gm04
Start: 4145000
stop: 4149937
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma04g05480
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G56450 AT
Annotation by Michelle Graham. TAIR10: Mitochondrial substrate carrier family protein | chr5:22858772-22859764 REVERSE LENGTH=330
SoyBase E_val: 0 ISS
GO:0006810 GO-bp
Annotation by Michelle Graham. GO Biological Process: transport
SoyBase N/A ISS
GO:0006839 GO-bp
Annotation by Michelle Graham. GO Biological Process: mitochondrial transport
SoyBase N/A ISS
GO:0048653 GO-bp
Annotation by Michelle Graham. GO Biological Process: anther development
SoyBase N/A ISS
GO:0055085 GO-bp
Annotation by Michelle Graham. GO Biological Process: transmembrane transport
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0005743 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial inner membrane
SoyBase N/A ISS
GO:0005215 GO-mf
Annotation by Michelle Graham. GO Molecular Function: transporter activity
SoyBase N/A ISS
GO:0005347 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ATP transmembrane transporter activity
SoyBase N/A ISS
KOG0749
KOG
Mitochondrial ADP/ATP carrier proteins
JGI ISS
PTHR24089 Panther
FAMILY NOT NAMED
JGI ISS
PTHR24089:SF155 Panther
JGI ISS
PF00153 PFAM
Mitochondrial carrier protein
JGI ISS
UniRef100_G7J7N8 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: ADP/ATP translocase-like protein n=1 Tax=Medicago truncatula RepID=G7J7N8_MEDTR
SoyBase E_val: 0 ISS
UniRef100_I1JTX3 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JTX3_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma04g05480
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma04g05480
Paralog Evidence Comments
Glyma06g05500 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma04g05480 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.04g051800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma04g05480
Coding sequences of Glyma04g05480
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma04g05480.1 sequence type=CDS gene model=Glyma04g05480 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGAGCGCAGCGGATGATGATGACCCAGAAAGGAGAAGATTGAATAGTGGGTTGAAGAGCTTTCAGCGCGATCTGATGGCTGGGGCGGTGATGGGTGGTGTGGTGCACACGATTGTGGCCCCAATTGAGAGGGCGAAGCTATTGTTGCAGACCCAAGAGAGCAACTTGGCGATTGTGGCGAGTGGGCGTCGCAGATTCAAGGGCATGTTGGATTGCATAGCCCGTACGGTCAGGGAAGAAGGCATTCTCTCTTTGTGGAGAGGCAATGGCAGCAGTGTTATTCGTTACTATCCTTCTGTCGCTCTCAATTTCTCTCTCAAGGATCTATACAAAAGCATGTTAAGAGGTGGAAACTCTAGTGACAATCTTTTGCCAGGTGCCACTGCTAATTTTGCAGCGGGCGCTGCAGCCGGCTGTACAACGCTTGTGTTGGTATACCCCCTTGATATAGCACACACGCGCCTTGCTGCTGACATTGGAAGGACAGACGTGCGCCAATTTCGAGGCATTTACCATTTCTTGGCTACCATATTCCACAAGGATGGCATTTGGGGGATCTACCGGGGCCTTCCTGCATCTCTACATGGGATGGTGGTACACAGGGGCCTTTATTTTGGAGGCTTTGATACCATGAAAGAGATCATGTCTGAAGAATCAAAACCTGAGTTGGCGTTGTGGAAGCGTTGGGTGGTAGCTCAGGCAGTCACAACCTCTGCCGGGTTGATATCTTATCCACTAGACACGGTTCGTAGGAGGATGATGATGCAATCTGGCATGGAACAGCCAGTGTACAACAGCACCTTGGACTGCTGGAGGAAGATCTATAGGACAGAGGGGTTGGCTTCATTTTACCGTGGTGCAGTTTCTAATGTGTTTAGGAGCACAGGAGCAGCAGCTATCTTAGTCTTGTACGATGAGGTTAAGAAATTTATGAACTGGGGGAGAATTTAA
Predicted protein sequences of Glyma04g05480
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma04g05480.1 sequence type=predicted peptide gene model=Glyma04g05480 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MSAADDDDPERRRLNSGLKSFQRDLMAGAVMGGVVHTIVAPIERAKLLLQTQESNLAIVASGRRRFKGMLDCIARTVREEGILSLWRGNGSSVIRYYPSVALNFSLKDLYKSMLRGGNSSDNLLPGATANFAAGAAAGCTTLVLVYPLDIAHTRLAADIGRTDVRQFRGIYHFLATIFHKDGIWGIYRGLPASLHGMVVHRGLYFGGFDTMKEIMSEESKPELALWKRWVVAQAVTTSAGLISYPLDTVRRRMMMQSGMEQPVYNSTLDCWRKIYRTEGLASFYRGAVSNVFRSTGAAAILVLYDEVKKFMNWGRI*