SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g05420

Feature Type:gene_model
Chromosome:Gm04
Start:4105154
stop:4111294
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g05420
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G33010AT Annotation by Michelle Graham. TAIR10: glycine decarboxylase P-protein 1 | chr4:15926852-15931150 REVERSE LENGTH=1037 SoyBaseE_val: 0ISS
GO:0000023GO-bp Annotation by Michelle Graham. GO Biological Process: maltose metabolic process SoyBaseN/AISS
GO:0000096GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur amino acid metabolic process SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006544GO-bp Annotation by Michelle Graham. GO Biological Process: glycine metabolic process SoyBaseN/AISS
GO:0006546GO-bp Annotation by Michelle Graham. GO Biological Process: glycine catabolic process SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0006733GO-bp Annotation by Michelle Graham. GO Biological Process: oxidoreduction coenzyme metabolic process SoyBaseN/AISS
GO:0006766GO-bp Annotation by Michelle Graham. GO Biological Process: vitamin metabolic process SoyBaseN/AISS
GO:0008652GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process SoyBaseN/AISS
GO:0009069GO-bp Annotation by Michelle Graham. GO Biological Process: serine family amino acid metabolic process SoyBaseN/AISS
GO:0009072GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family metabolic process SoyBaseN/AISS
GO:0009073GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family biosynthetic process SoyBaseN/AISS
GO:0009106GO-bp Annotation by Michelle Graham. GO Biological Process: lipoate metabolic process SoyBaseN/AISS
GO:0009108GO-bp Annotation by Michelle Graham. GO Biological Process: coenzyme biosynthetic process SoyBaseN/AISS
GO:0009117GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide metabolic process SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010304GO-bp Annotation by Michelle Graham. GO Biological Process: PSII associated light-harvesting complex II catabolic process SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019464GO-bp Annotation by Michelle Graham. GO Biological Process: glycine decarboxylation via glycine cleavage system SoyBaseN/AISS
GO:0019748GO-bp Annotation by Michelle Graham. GO Biological Process: secondary metabolic process SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0042545GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall modification SoyBaseN/AISS
GO:0043085GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of catalytic activity SoyBaseN/AISS
GO:0044272GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur compound biosynthetic process SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005960GO-cc Annotation by Michelle Graham. GO Cellular Compartment: glycine cleavage complex SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004375GO-mf Annotation by Michelle Graham. GO Molecular Function: glycine dehydrogenase (decarboxylating) activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0030170GO-mf Annotation by Michelle Graham. GO Molecular Function: pyridoxal phosphate binding SoyBaseN/AISS
KOG2040 KOG Glycine dehydrogenase (decarboxylating) JGI ISS
PTHR11773Panther GLYCINE DEHYDROGENASE JGI ISS
PF02347PFAM Glycine cleavage system P-protein JGI ISS
UniRef100_G7I9Z0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glycine dehydrogenase P protein n=1 Tax=Medicago truncatula RepID=G7I9Z0_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1JTW7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JTW7_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g05420
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g05420
ParalogEvidenceComments
Glyma06g05470 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g05420 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g051200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g05420
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g05420
>Glyma04g05420.1   sequence type=CDS   gene model=Glyma04g05420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAACGTGCCCGGAGGCTAGCAAACAAGGCGATTCTCAAGAGGCTAATTTCCTCGGCCAAGGTTAATTCCCATTCGCGTTCTCTTTCATCTATTTCCCATTCCTTTTCATTACCCAAACCAGAGAACCCGATCGGAAACAACCGAAAACTCTCACATAATGTCCCATCTCGATTCATTTCACTGGATGCGCTCAAGCCGAGCGACACATTCCCACGGCGCCACAACTCGGCCACCTCGGAGGAACAAAGCAAGATGGCCCAGACATGCGGCTTCGACAGCCTGGACTCCCTCATCGACGCCACCGTCCCGAAATCAATCCGTCTGAACGACATGTCGTTCAGCGTCTTCAACGAGGGGCTAACGGAGTCGGAAATGTCGTCGCACATGAACAGCTTGGCGTCGAAGAACAAGTGCTTCAAGTCGTACATCGGGATGGGGTACTACAACACGCACGTGCCGCCCGTGATCCTGCGGAACATCATGGAGAACCCCGCCTGGTACACTCAGTACACTCCTTACCAGGCCGAGATATCTCAGGGCCGTCTCGAGTCCCTCATGAATTTCCAAACCATGATCTCAGATCTCACCGCGCTTCCAATGTCCAACGCTTCCTTGCTCGACGAAGGAACTGCGGCCGCTGAAGCAATGTCAATGTGTAACAACATCCACAAGGGAAAAAGAAAGACTTTTATCATTGCCAGTAACTGTCACCCTCAAACTGTTGATGTTTGCATAACCAGAGCGTCTGGTTTTGGTATTAAGGTTGTTACTGCGGATGTTAAGGATGTGGACTATAAATCCGGTGATGTTTGTGGGGTTCTTGTTCAGTACCCGGGGACTGAGGGTGAGATTTTGGACTATGGAGAGTTTGTAGAGGAGGCTCATGCGCATGGAGTGAAGGTTGTTATGGGGACTGATTTGTTGGCTCTGACTGTGCTGAAGCCTCCTGGGGAAATGGGGGTGGATATTGTTGTTGGCTCTGCTCAGAGGTTTGGGGTTCCGATGGGGTATGGGGGTCCACACGCCGCATTCCTCGCCACATCGCAAGAGTATAAGAGGATGATGCCTGGGAGGATCATTGGGGTCAGTGTTGATTCTTCTGGAAAGCCGGCTTTGAGAATGGCCATGCAAACTAGGGAGCAGCATATCCGGAGGGACAAGGCCACTAGCAACATTTGCACTGCTCAGGCACTGCTTGCAAACATGGCTGCTATGTATGCTGTATATCATGGACCTGAAGGACTTAAAACCATTGCCCAACGGGTTCATGGTCTTGCTGGGGTGTTTGCTCAGGGATTAAAGAAACTTGGAACCGTGGAAGTTCAGGACCATCCATTCTTTGACACTGTGAAAATTAGGACTGCCAATGCCCATGCAATTGCTGATGCTGCTTGCAAGAATGAAATCAATTTGCGGGTTGTTGATGGGAACACTATCACTGTTGCCTTTGATGAAACAACCACCTTGGAGGATGTTGATAATCTTTTCAAAGTTTTTTCTAATGGCAAGCCTGTCTCCTTCACAGCTGCATCTCTTGCACCAGAAGTTCAGACTGCACTTCCTTCTGGACTTACTAGAAAGAGTCCTTATCTGACACACCCTATCTTTAACACGTACCACACTGAGCATGAGCTTCTCAGGTACATTCATAGGCTACAATCAAAAGATCTTTCATTGTGCCACAGTATGATCCCGCTAGGATCTTGTACAATGAAGCTGAACGCTACAACTGAAATGATGCCTGTGACATGGCCTAGCTTTGCTAACATTCACCCTTTTGCACCGATTGAACAGGCTCAAGGTTATCAGGAAATGTTCGAAAATTTGGGTAAATTGCTGTGTACAATCACTGGGTTTGATTCCTTCTCTTTGCAACCTAATGCTGGTGCTGCCGGAGAATATGCTGGACTGATGGTTATTCGTGCATATCATTTGGCAAGAGGAGACCACCATCGCAATGTCTGCATTATACCTGTCTCAGCACATGGTACAAATCCTGCCAGTGCTGCTATGTGTGCAATGAAAATTGTATCTGTTGGAACTGATGCCAAGGGAAACATCAATATTGATGAGTTGAGGAAGGCTGCTGAAACACATAAGGACAACCTAGCTGCTCTCATGGTAACATATCCTTCAACCCATGGTGTTTATGAAGAAGGTATTGATGAGATATGCAAGATTATTCATGATAATGGAGGTCAAGTATATATGGATGGTGCTAACATGAATGCACAGGTAGGACTTACAAGCCCAGGTTGGATTGGAGCAGATGTTTGCCATCTGAATCTCCATAAGACATTTTGCATCCCTCATGGAGGAGGTGGCCCTGGCATGGGTCCTATTGGAGTAAAGAAACACTTGGCACCATTTTTACCATCACATCCAGTGGTTCCCACTGGTGGCATTCCTGCCCCTGGCAAGTCACAACCACTTGGTACCATTTCTGCTGCACCATGGGGCTCAGCACTGATATTGCCTATCTCATACTCTTACATAGCCATGATGGGTTCTAAAGGACTCACCGAAGCATCAAAAACAGCCATTTTGAATGCAAACTATATGGCAAAACGATTGGAGAATCATTACCCTGTTCTTTTCCGTGGGGTCAATGGAACAGTTGCTCATGAATTCATTATTGACTTAAGAGGCTTTAAGAATACTGCTGGGATAGAGCCTGAAGATGTTGCAAAGCGCCTTATGGACTATGGTTTCCATAGTCCGACAATGTCATTTCCTGTGCCTGGCACACTCATGATTGAGCCAACTGAAAGTGAAAGCAAGGCCGAGCTAGACAGGTTTTGTGATGCTCTTATTTCCATTCGACAAGAAATTGCTGAGATTGAGAAAGGAAAGGCCGACATTAACAACAATGTTCTAAAGTGTGCCCCTCATCCACCATCAGTGCTCATGGGAGATGCATGGACAAAACCATACTCTCGAGAATATGCTGCCTTCCCAGCTTCCTGGCTTCGTGTTTCTAAGTTCTGGCCTTCCACAGGACGTATTGATAATGTGTACGGTGATCGCAACCTCGTTTGCACCCTTCTCCCAACATCACAGGTTGTTGAAGAACAAGCTGCTGCAACGGCCTAA
Predicted protein sequences of Glyma04g05420
>Glyma04g05420.1   sequence type=predicted peptide   gene model=Glyma04g05420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MERARRLANKAILKRLISSAKVNSHSRSLSSISHSFSLPKPENPIGNNRKLSHNVPSRFISLDALKPSDTFPRRHNSATSEEQSKMAQTCGFDSLDSLIDATVPKSIRLNDMSFSVFNEGLTESEMSSHMNSLASKNKCFKSYIGMGYYNTHVPPVILRNIMENPAWYTQYTPYQAEISQGRLESLMNFQTMISDLTALPMSNASLLDEGTAAAEAMSMCNNIHKGKRKTFIIASNCHPQTVDVCITRASGFGIKVVTADVKDVDYKSGDVCGVLVQYPGTEGEILDYGEFVEEAHAHGVKVVMGTDLLALTVLKPPGEMGVDIVVGSAQRFGVPMGYGGPHAAFLATSQEYKRMMPGRIIGVSVDSSGKPALRMAMQTREQHIRRDKATSNICTAQALLANMAAMYAVYHGPEGLKTIAQRVHGLAGVFAQGLKKLGTVEVQDHPFFDTVKIRTANAHAIADAACKNEINLRVVDGNTITVAFDETTTLEDVDNLFKVFSNGKPVSFTAASLAPEVQTALPSGLTRKSPYLTHPIFNTYHTEHELLRYIHRLQSKDLSLCHSMIPLGSCTMKLNATTEMMPVTWPSFANIHPFAPIEQAQGYQEMFENLGKLLCTITGFDSFSLQPNAGAAGEYAGLMVIRAYHLARGDHHRNVCIIPVSAHGTNPASAAMCAMKIVSVGTDAKGNINIDELRKAAETHKDNLAALMVTYPSTHGVYEEGIDEICKIIHDNGGQVYMDGANMNAQVGLTSPGWIGADVCHLNLHKTFCIPHGGGGPGMGPIGVKKHLAPFLPSHPVVPTGGIPAPGKSQPLGTISAAPWGSALILPISYSYIAMMGSKGLTEASKTAILNANYMAKRLENHYPVLFRGVNGTVAHEFIIDLRGFKNTAGIEPEDVAKRLMDYGFHSPTMSFPVPGTLMIEPTESESKAELDRFCDALISIRQEIAEIEKGKADINNNVLKCAPHPPSVLMGDAWTKPYSREYAAFPASWLRVSKFWPSTGRIDNVYGDRNLVCTLLPTSQVVEEQAAATA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo