SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g05410

Feature Type:gene_model
Chromosome:Gm04
Start:4101041
stop:4102361
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g05410
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G10970AT Annotation by Michelle Graham. TAIR10: zinc transporter 4 precursor | chr1:3665201-3666933 REVERSE LENGTH=408 SoyBaseE_val: 5.00E-116ISS
GO:0006812GO-bp Annotation by Michelle Graham. GO Biological Process: cation transport SoyBaseN/AISS
GO:0030001GO-bp Annotation by Michelle Graham. GO Biological Process: metal ion transport SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0071577GO-bp Annotation by Michelle Graham. GO Biological Process: zinc ion transmembrane transport SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0005375GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion transmembrane transporter activity SoyBaseN/AISS
GO:0005385GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion transmembrane transporter activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008324GO-mf Annotation by Michelle Graham. GO Molecular Function: cation transmembrane transporter activity SoyBaseN/AISS
GO:0046873GO-mf Annotation by Michelle Graham. GO Molecular Function: metal ion transmembrane transporter activity SoyBaseN/AISS
KOG1558 KOG Fe2+/Zn2+ regulated transporter JGI ISS
PTHR11040Panther ZINC-IRON TRANSPORTER JGI ISS
PTHR11040:SF1Panther ZINC/IRON TRANSPORTER JGI ISS
PF02535PFAM ZIP Zinc transporter JGI ISS
UniRef100_G7J7M9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome c oxidase subunit n=1 Tax=Medicago truncatula RepID=G7J7M9_MEDTR SoyBaseE_val: 2.00E-115ISS
UniRef100_UPI000233A7D9UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233A7D9 related cluster n=1 Tax=unknown RepID=UPI000233A7D9 SoyBaseE_val: 1.00E-180ISS

Expression Patterns of Glyma04g05410
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g05410
ParalogEvidenceComments
Glyma06g05460 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g05410 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g051100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g05410
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g05410
>Glyma04g05410.2   sequence type=CDS   gene model=Glyma04g05410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACCAACTCAAGCTGCGGAGGCGCCGAGTTGGAGCTATGCCGAGATGAATCGGCCGCATTGCTTCTCAAGTTCTTCGCCATCGCCTCCATTCTCCTCGCCGGCATGGCCGGGATCGCCATCCCGCTCGTCCGAAAACACCTCCGCACCGACGGCAACCTCTTCGTCGCGGCCAAGGCCTTCGCCGCAGGCGTCATTCTCGCCACCGGATTCGTCCACATGCTCTCCGACGCCACCGAGGCGCTCCAGCACCCGTGCCTGCCTTCGTTCCCGTGGTCCAAGTTTCCCTTCACGGGGTTCTTCGCCATCGGTGGAATGCACATCGTGGGGATGCATGCACATGCTGCACATCATAGACATAACCATCCTCATGGCAATAATGCATGTCATGGCACTGGCGACGTCAAGGAACACTCCCACTCCCACTCCCACATCGAAGAAGGAGAAGAAACTGACGTTCGACACGTCGTCGTTTCTCAGTCCTTGTACATAAGGCCTTTAATTGCGGCGCTATCGTTTCATCAGTTTTTTGAAGGGTTTGCGCTTGGAGGGTGCATTTCCCAAGCGCAGTTTAAAGCCTCGTCAGCAACTATAATGGCTTGGTTTTTTGCACTGACTACACCCTTGGGTGTCGGGATTGGAACGGCTATTTCTTCCGGGTATAACCCTTACAGCCCAGGTGCACTCATCACCCAAGGTATCTTGGATTCCTCGTCGTCGGGGATTTTGGTGTATATGGCTTTGGTAGATTTGATAGCTGCGGATTTTCTTAGCAAGAGGATGAGTTGTAACTTTAGGCTGCAGATACTGTCTTACTGCATGCTTTTCATTGGGGCTGGATTGATGTCTTCCCTCGCTATTTGGGCCTGA
Predicted protein sequences of Glyma04g05410
>Glyma04g05410.2   sequence type=predicted peptide   gene model=Glyma04g05410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTNSSCGGAELELCRDESAALLLKFFAIASILLAGMAGIAIPLVRKHLRTDGNLFVAAKAFAAGVILATGFVHMLSDATEALQHPCLPSFPWSKFPFTGFFAIGGMHIVGMHAHAAHHRHNHPHGNNACHGTGDVKEHSHSHSHIEEGEETDVRHVVVSQSLYIRPLIAALSFHQFFEGFALGGCISQAQFKASSATIMAWFFALTTPLGVGIGTAISSGYNPYSPGALITQGILDSSSSGILVYMALVDLIAADFLSKRMSCNFRLQILSYCMLFIGAGLMSSLAIWA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo