SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 156 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g05210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g05210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g05210

Feature Type:gene_model
Chromosome:Gm04
Start:3960637
stop:3966267
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G08150AT Annotation by Michelle Graham. TAIR10: KNOTTED-like from Arabidopsis thaliana | chr4:5147969-5150610 REVERSE LENGTH=398 SoyBaseE_val: 2.00E-137ISS
GO:0001708GO-bp Annotation by Michelle Graham. GO Biological Process: cell fate specification SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007389GO-bp Annotation by Michelle Graham. GO Biological Process: pattern specification process SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009944GO-bp Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0045165GO-bp Annotation by Michelle Graham. GO Biological Process: cell fate commitment SoyBaseN/AISS
GO:0048438GO-bp Annotation by Michelle Graham. GO Biological Process: floral whorl development SoyBaseN/AISS
GO:0048439GO-bp Annotation by Michelle Graham. GO Biological Process: flower morphogenesis SoyBaseN/AISS
GO:0048513GO-bp Annotation by Michelle Graham. GO Biological Process: organ development SoyBaseN/AISS
GO:0048519GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
KOG0773 KOG Transcription factor MEIS1 and related HOX domain proteins JGI ISS
PTHR11850Panther HOMEOBOX PROTEIN JGI ISS
PTHR11850:SF50Panther PRE-B-CELL LEUKEMIA TRANSCRIPTION FACTOR 2 JGI ISS
PF00046PFAM Homeobox domain JGI ISS
PF03789PFAM ELK domain JGI ISS
PF03790PFAM KNOX1 domain JGI ISS
PF03791PFAM KNOX2 domain JGI ISS
UniRef100_I1JTU5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JTU5_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1M8Y1UniRef Annotation by Michelle Graham. Most informative UniRef hit: KNOX-like DNA-binding protein n=1 Tax=Glycine max RepID=I1M8Y1_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g05210 not represented in the dataset

Glyma04g05210 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g049500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma04g05210.1   sequence type=CDS   gene model=Glyma04g05210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGAATACACCAATAATCACCTGAGCCAAAACACAAGTCCAAGGGCAAATTTGTTGTATTCTTTGGCTGGTGGTTCAAGCGTAGGAAACCGCCACCACCAACTAATTCCATTTAACACCTTTCATCTTCAAACGGGTAGATCGGATCACTGTTTTCAACCGGATCAAGCACCACACCCTAGTGTGAAAACCGAGTCCAACAATTCCCATCTTCACTATCCTCTAATGAGATCAAATCTTCACCACATGCTGCATCCTCAGCAAGGAGGGAGCCAGAGCTCTAACGAACTTGAAGCCATAAAAGCCAAAATCATTGACCATCCTCACTACTCAAATCTTTTACAAGTTTACATGGATTGCCAAAAGGTAGGAGCTCCGCCAGAAGTGGCGGCGCGTTTTGCTACGGTTAAAGAGAATTTTGAGGCACGGCAGCGATCTTTGGTTAGGTCAATGGAAACTTGCAAGGACCCAGAACTTGATCAATTCATGGAAGCTTACTATGACATGCTAGTGAAGTATCGAGAGGAATTAACGAGGCCTATAGAAGAGGCTAAGGATTTCATGCAGAGGATAGAATCTCAGCTGAACACGCTTTGCAATGGAACCGTGCGGATCTTCTCTGATGATAAGTGGGAAAACATTGGTTCATCATCGGAAGAGGATAAAGACAACAGTGGTCGAGAAACAGAATTGATCGAGATTGATCCCCAAGCGGAAGACCGTGAACTCAAAAGCCACTTGCTCAAGAAGTACAGTGGCTACTTAGGTACCCTTAAGAAAGAACTTTCTAAGAAAAAGAAAAAAGGAAAACTGCCTAAAGATGCTAGGCAAAAGCTACTTAGCTGGTGGGAATTACATTACAAATGGCCATATCCTTCGGAATCAGAGAAGGTGGCGCTGGCTGAAGCAACTGGTTTGGATCAGAAGCAAATAAATAACTGGTTCATAAATCAAAGGAAACGGCACTGGAAACCATCGGAAGACATGCAATTTATGGTTATGGATGGCTTGCATGCGCAGAATGCAACTCTCTATATGGATGGCCACTACATGGCTAATGACCATTACCGTTTATGGCCATAA

>Glyma04g05210.1   sequence type=predicted peptide   gene model=Glyma04g05210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEEYTNNHLSQNTSPRANLLYSLAGGSSVGNRHHQLIPFNTFHLQTGRSDHCFQPDQAPHPSVKTESNNSHLHYPLMRSNLHHMLHPQQGGSQSSNELEAIKAKIIDHPHYSNLLQVYMDCQKVGAPPEVAARFATVKENFEARQRSLVRSMETCKDPELDQFMEAYYDMLVKYREELTRPIEEAKDFMQRIESQLNTLCNGTVRIFSDDKWENIGSSSEEDKDNSGRETELIEIDPQAEDRELKSHLLKKYSGYLGTLKKELSKKKKKGKLPKDARQKLLSWWELHYKWPYPSESEKVALAEATGLDQKQINNWFINQRKRHWKPSEDMQFMVMDGLHAQNATLYMDGHYMANDHYRLWP*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo