Glyma04g05210 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g05210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g05210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g05210

Feature Type:	gene_model
Chromosome:	Gm04
Start:	3960637
stop:	3966267
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g05210

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G08150	AT	Annotation by Michelle Graham. TAIR10: KNOTTED-like from Arabidopsis thaliana \| chr4:5147969-5150610 REVERSE LENGTH=398	SoyBase	E_val: 2.00E-137	ISS
GO:0001708	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell fate specification	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007389	GO-bp	Annotation by Michelle Graham. GO Biological Process: pattern specification process	SoyBase	N/A	ISS
GO:0009855	GO-bp	Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry	SoyBase	N/A	ISS
GO:0009887	GO-bp	Annotation by Michelle Graham. GO Biological Process: organ morphogenesis	SoyBase	N/A	ISS
GO:0009944	GO-bp	Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis	SoyBase	N/A	ISS
GO:0010014	GO-bp	Annotation by Michelle Graham. GO Biological Process: meristem initiation	SoyBase	N/A	ISS
GO:0010051	GO-bp	Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation	SoyBase	N/A	ISS
GO:0045165	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell fate commitment	SoyBase	N/A	ISS
GO:0048438	GO-bp	Annotation by Michelle Graham. GO Biological Process: floral whorl development	SoyBase	N/A	ISS
GO:0048439	GO-bp	Annotation by Michelle Graham. GO Biological Process: flower morphogenesis	SoyBase	N/A	ISS
GO:0048513	GO-bp	Annotation by Michelle Graham. GO Biological Process: organ development	SoyBase	N/A	ISS
GO:0048519	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
KOG0773	KOG	Transcription factor MEIS1 and related HOX domain proteins	JGI		ISS
PTHR11850	Panther	HOMEOBOX PROTEIN	JGI		ISS
PTHR11850:SF50	Panther	PRE-B-CELL LEUKEMIA TRANSCRIPTION FACTOR 2	JGI		ISS
PF00046	PFAM	Homeobox domain	JGI		ISS
PF03789	PFAM	ELK domain	JGI		ISS
PF03790	PFAM	KNOX1 domain	JGI		ISS
PF03791	PFAM	KNOX2 domain	JGI		ISS
UniRef100_I1JTU5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JTU5_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_I1M8Y1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: KNOX-like DNA-binding protein n=1 Tax=Glycine max RepID=I1M8Y1_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma04g05210

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g05210 not represented in the dataset	Glyma04g05210 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g05210 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g049500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g05210

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g05210

Limit To All Plant Sequences

>Glyma04g05210.1   sequence type=CDS   gene model=Glyma04g05210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGAATACACCAATAATCACCTGAGCCAAAACACAAGTCCAAGGGCAAATTTGTTGTATTCTTTGGCTGGTGGTTCAAGCGTAGGAAACCGCCACCACCAACTAATTCCATTTAACACCTTTCATCTTCAAACGGGTAGATCGGATCACTGTTTTCAACCGGATCAAGCACCACACCCTAGTGTGAAAACCGAGTCCAACAATTCCCATCTTCACTATCCTCTAATGAGATCAAATCTTCACCACATGCTGCATCCTCAGCAAGGAGGGAGCCAGAGCTCTAACGAACTTGAAGCCATAAAAGCCAAAATCATTGACCATCCTCACTACTCAAATCTTTTACAAGTTTACATGGATTGCCAAAAGGTAGGAGCTCCGCCAGAAGTGGCGGCGCGTTTTGCTACGGTTAAAGAGAATTTTGAGGCACGGCAGCGATCTTTGGTTAGGTCAATGGAAACTTGCAAGGACCCAGAACTTGATCAATTCATGGAAGCTTACTATGACATGCTAGTGAAGTATCGAGAGGAATTAACGAGGCCTATAGAAGAGGCTAAGGATTTCATGCAGAGGATAGAATCTCAGCTGAACACGCTTTGCAATGGAACCGTGCGGATCTTCTCTGATGATAAGTGGGAAAACATTGGTTCATCATCGGAAGAGGATAAAGACAACAGTGGTCGAGAAACAGAATTGATCGAGATTGATCCCCAAGCGGAAGACCGTGAACTCAAAAGCCACTTGCTCAAGAAGTACAGTGGCTACTTAGGTACCCTTAAGAAAGAACTTTCTAAGAAAAAGAAAAAAGGAAAACTGCCTAAAGATGCTAGGCAAAAGCTACTTAGCTGGTGGGAATTACATTACAAATGGCCATATCCTTCGGAATCAGAGAAGGTGGCGCTGGCTGAAGCAACTGGTTTGGATCAGAAGCAAATAAATAACTGGTTCATAAATCAAAGGAAACGGCACTGGAAACCATCGGAAGACATGCAATTTATGGTTATGGATGGCTTGCATGCGCAGAATGCAACTCTCTATATGGATGGCCACTACATGGCTAATGACCATTACCGTTTATGGCCATAA

Predicted protein sequences of Glyma04g05210

Limit To All Plant Sequences

>Glyma04g05210.1   sequence type=predicted peptide   gene model=Glyma04g05210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEEYTNNHLSQNTSPRANLLYSLAGGSSVGNRHHQLIPFNTFHLQTGRSDHCFQPDQAPHPSVKTESNNSHLHYPLMRSNLHHMLHPQQGGSQSSNELEAIKAKIIDHPHYSNLLQVYMDCQKVGAPPEVAARFATVKENFEARQRSLVRSMETCKDPELDQFMEAYYDMLVKYREELTRPIEEAKDFMQRIESQLNTLCNGTVRIFSDDKWENIGSSSEEDKDNSGRETELIEIDPQAEDRELKSHLLKKYSGYLGTLKKELSKKKKKGKLPKDARQKLLSWWELHYKWPYPSESEKVALAEATGLDQKQINNWFINQRKRHWKPSEDMQFMVMDGLHAQNATLYMDGHYMANDHYRLWP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain