SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g05131

Feature Type:gene_model
Chromosome:Gm04
Start:3865882
stop:3867304
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g05131
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G58440AT Annotation by Michelle Graham. TAIR10: FAD/NAD(P)-binding oxidoreductase family protein | chr1:21714094-21717246 REVERSE LENGTH=531 SoyBaseE_val: 5.00E-130ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009228GO-bp Annotation by Michelle Graham. GO Biological Process: thiamine biosynthetic process SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0016126GO-bp Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process SoyBaseN/AISS
GO:0016132GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process SoyBaseN/AISS
GO:0019745GO-bp Annotation by Michelle Graham. GO Biological Process: pentacyclic triterpenoid biosynthetic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0004506GO-mf Annotation by Michelle Graham. GO Molecular Function: squalene monooxygenase activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0050660GO-mf Annotation by Michelle Graham. GO Molecular Function: flavin adenine dinucleotide binding SoyBaseN/AISS
PTHR10835Panther SQUALENE MONOOXYGENASE JGI ISS
PF08491PFAM Squalene epoxidase JGI ISS
UniRef100_Q8GSM8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Squalene monooxygenase 1 n=1 Tax=Medicago truncatula RepID=Q8GSM8_MEDTR SoyBaseE_val: 7.00E-146ISS
UniRef100_UPI0002339682UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339682 related cluster n=1 Tax=unknown RepID=UPI0002339682 SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g05131
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g05131 not represented in the dataset
Glyma04g05131 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g05131 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g048500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g05131
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g05131
>Glyma04g05131.1   sequence type=CDS   gene model=Glyma04g05131   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTGTGCGACTGGAGCAGGAACAGCTACTTCCCTAATTGAAGAGAAGGGGATAATTAAAGGCATGCGCTACAAAACGAAGGATAATAAGGAATTTTCAGCTTGTGCACCCCTTACCATTGTCTGTGATGGCAGTTCCTCAAATTTGCGTCGTTCTCTGTGTAATCCTAAGGTAGACGTTCCCTCTCGTTTTGTTGGCTTAGTTTTGGAGAATTGTCCTTGTGCAAATCATAGCCATCTCATATTGGGAGATCCTTCGCCAGTTGTGTTCTATCCTATAAGTAGTTCAGAAGTCCGTTGTCTTGTTGATGTTCCTGGTCAGAAAGTTCCATCCATTTCCAATGGTGAAATGGCAAAGTATTTGAAGACAGTGATAGCTCCACAGATTCCTCTTGAGCTTCATGACGCTTTCATAGCCGCAGTGGACAAAGGCAACATAAGGACAATGCGAAACAGAAGCAAGCCAGCAGCTTCTTATCCTACTCCTGGAGCCCAGCTGATGGGAGATGCATTCAACATGGGGTATTTGCGTGACCTGAGTGATGCACCTAGCCTTTGCAAATACCTTGAATCCTTTTATACCTTGCGCAAGAAGCCCTTTACAAGGGAGGAAATGCGCCAAGCTTGCTTCGATTATCTTAGTCTTGGAGGTCTATTCTCGGAGGGTCCAGTCTCTTTGCTTTCAGGATTAAACCCTCGACCTTTGAGTCTGGTTCTACATTTCTTTGCTGTTGCAATATATGGTGTTGGCCGTTTGCTGCTACCATTTCCTGCACCTAAACGGATATGGATTGGAGTCCGATTAATTTCTGTAAGTATTAGCAACAGTTTTGTACTTCGTTCTCTAACCTAG
Predicted protein sequences of Glyma04g05131
>Glyma04g05131.1   sequence type=predicted peptide   gene model=Glyma04g05131   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MCATGAGTATSLIEEKGIIKGMRYKTKDNKEFSACAPLTIVCDGSSSNLRRSLCNPKVDVPSRFVGLVLENCPCANHSHLILGDPSPVVFYPISSSEVRCLVDVPGQKVPSISNGEMAKYLKTVIAPQIPLELHDAFIAAVDKGNIRTMRNRSKPAASYPTPGAQLMGDAFNMGYLRDLSDAPSLCKYLESFYTLRKKPFTREEMRQACFDYLSLGGLFSEGPVSLLSGLNPRPLSLVLHFFAVAIYGVGRLLLPFPAPKRIWIGVRLISVSISNSFVLRSLT*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo