SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g04821

Feature Type:gene_model
Chromosome:Gm04
Start:3579371
stop:3581977
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g04821
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G37630AT Annotation by Michelle Graham. TAIR10: cyclin d5;1 | chr4:17679497-17680788 FORWARD LENGTH=321 SoyBaseE_val: 1.00E-49ISS
GO:0000278GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic cell cycle SoyBaseN/AISS
GO:0010440GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal lineage progression SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0045736GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of cyclin-dependent protein kinase activity SoyBaseN/AISS
GO:0051726GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0004693GO-mf Annotation by Michelle Graham. GO Molecular Function: cyclin-dependent protein kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG0656 KOG G1/S-specific cyclin D JGI ISS
PTHR10177Panther CYCLINS JGI ISS
PTHR10177:SF76Panther CYCLIN-D JGI ISS
PF00134PFAM Cyclin, N-terminal domain JGI ISS
PF02984PFAM Cyclin, C-terminal domain JGI ISS
UniRef100_D3YBB0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cyclin d n=1 Tax=Trifolium repens RepID=D3YBB0_TRIRP SoyBaseE_val: 1.00E-110ISS
UniRef100_UPI0002339512UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339512 related cluster n=1 Tax=unknown RepID=UPI0002339512 SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g04821
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g04821 not represented in the dataset
Glyma04g04821 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g04821
ParalogEvidenceComments
Glyma06g04910 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g04821 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g045500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g04821
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g04821
>Glyma04g04821.1   sequence type=CDS   gene model=Glyma04g04821   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATGATCTTTCATCCAGCCTTCTGTGCCAAGAAAACGAAACGTGTTTGGAAGAAGGAGGTGAAGAATTAGAATACCAATTCGTTGGATCACAGCATGATTGTGGGGTTTCAGAGGATGAACATGTGGGAATTTTGATTGAGAGAGAGATCGTTCTTGGGTTCAAAAAGGATGAAACTATGGTGATTGGGGACTGGGTGAAACGTGCACGCATGGAAGCAATCAATTGGGTTCTCAAAACAAGAGCAACACTGGGTTTTCGCTTCGAAACGGCTTATTTGTCAGTCACATACTTCGATCGATTTCTTTTCAGACGGTCCATTGATAGTGAAAAGAGTTGGGCAATTCGGTTGCTATCAATTGCATGTCTCTCTCTGGCTGCAAAGATGGAGGAGTGCATTGTGCCGGGGCTATCAGAGTTCAAATTGGATGATTATTCCTTTGAGGGAAAAGTGATTCAGAAAATGGAGCTTTTGGTGCTCAGCACATTGGAGTGGAAAATGGGAATCATCACTCCATTTGATTTCCTTTCCTATTTCATCAGAAAAATCTGCAAAGAATCCCCACCAAGTCCTATTTTTTCCAAGACCATGCAACTCATCTTCACCACAATGAAAGAGGTCAATTTAATGGATCACAAGCCATCAGTTATTGCTGCGGCAGCTACTTTGGTGGCAATGGATCAGCAATTAACGATAGATGCGGTGGAGTTGAAGATGAGTTCAATTCCACAACATAGGCTTCTAGAATCTAAAGATGTATTTGAGTACTACAATCTAATTCAAAGATTATACGAGGAGAATACCAAAAGCGACACGCATACGCCAATTGAGATGACAGAGAGCTCCCGAGTTACTTCTTCTGCAGCAATGGCAAAGAGAAGAAGACTCGCATTCAGTGATGATGAAGGAAGTAGTCATGGGAAGGGACCGGGCTAG
Predicted protein sequences of Glyma04g04821
>Glyma04g04821.1   sequence type=predicted peptide   gene model=Glyma04g04821   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDDLSSSLLCQENETCLEEGGEELEYQFVGSQHDCGVSEDEHVGILIEREIVLGFKKDETMVIGDWVKRARMEAINWVLKTRATLGFRFETAYLSVTYFDRFLFRRSIDSEKSWAIRLLSIACLSLAAKMEECIVPGLSEFKLDDYSFEGKVIQKMELLVLSTLEWKMGIITPFDFLSYFIRKICKESPPSPIFSKTMQLIFTTMKEVNLMDHKPSVIAAAATLVAMDQQLTIDAVELKMSSIPQHRLLESKDVFEYYNLIQRLYEENTKSDTHTPIEMTESSRVTSSAAMAKRRRLAFSDDEGSSHGKGPG*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo