SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g04450

Feature Type:gene_model
Chromosome:Gm04
Start:3292928
stop:3297698
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g04450
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G46630AT Annotation by Michelle Graham. TAIR10: Protein of unknown function (DUF3223) | chr3:17181138-17182346 REVERSE LENGTH=207 SoyBaseE_val: 2.00E-74ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0042631GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to water deprivation SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF11523PFAM Protein of unknown function (DUF3223) JGI ISS
UniRef100_B6T2W0UniRef Annotation by Michelle Graham. Most informative UniRef hit: DCL protein n=1 Tax=Zea mays RepID=B6T2W0_MAIZE SoyBaseE_val: 7.00E-56ISS
UniRef100_I1JTM4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JTM4_SOYBN SoyBaseE_val: 2.00E-149ISS

Expression Patterns of Glyma04g04450
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g04450 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g041900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g04450
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g04450
>Glyma04g04450.1   sequence type=CDS   gene model=Glyma04g04450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCTCTCTTTTTCTTAGACAGGCTCTGCTCCTCCGCGTTTGCTTCCACAACTACCAACGCTTCACCGCCGGAGGCGTCGCCGCACGTCACCGGCTGTGGTGCAGCGCAGCCGCCAACCTACCGTCAGACGAAGCGGAGAAGAAAACAAACTCCGGCGGCATCAGCAACAGCTCCTTTGCACGGAAAGCTCAGTATCCTCCGTCAAGTGAAGCGCGGTGGGAGGACGACCCCGATTACCGCAAATGGAAGGACAAAGAAAAGGAGATTCTCAGCGACATTGAACCTATCGTTGTTCTCGCCAAGGATATTCTCCACTCACGAAGGTACATGGATGGAGCGCGATTGAATGAGGAGGACGAGAAGGCTATAGTTGAGAAGCTCCTTGCATACCATCCACATTCTGAAGATAAGATTGGGTGTGGCCTTGAATCCATTATGGTTGACCGTCATCCCCAATATCGACAATCAAGGTGTCTTTTTGTTGTAAGAACTGATGGTGGCTGGATTGATTTCTCCTATCAGAAGTGCCTTCGGGAATACATTAGAGATAAGTACCCTACTCATGCGGAAAGGTTTATTAGAGAACATTTTAAGCGTGGGAGTGGTTGA
Predicted protein sequences of Glyma04g04450
>Glyma04g04450.1   sequence type=predicted peptide   gene model=Glyma04g04450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASLFLRQALLLRVCFHNYQRFTAGGVAARHRLWCSAAANLPSDEAEKKTNSGGISNSSFARKAQYPPSSEARWEDDPDYRKWKDKEKEILSDIEPIVVLAKDILHSRRYMDGARLNEEDEKAIVEKLLAYHPHSEDKIGCGLESIMVDRHPQYRQSRCLFVVRTDGGWIDFSYQKCLREYIRDKYPTHAERFIREHFKRGSG*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo