Glyma04g03970 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g03970

Feature Type:	gene_model
Chromosome:	Gm04
Start:	2912274
stop:	2914340
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g03970

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G26560	AT	Annotation by Michelle Graham. TAIR10: phospholipase A 2A \| chr2:11293912-11295708 REVERSE LENGTH=407	SoyBase	E_val: 3.00E-101	ISS
GO:0000165	GO-bp	Annotation by Michelle Graham. GO Biological Process: MAPK cascade	SoyBase	N/A	ISS
GO:0002237	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to molecule of bacterial origin	SoyBase	N/A	ISS
GO:0002679	GO-bp	Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response	SoyBase	N/A	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0006629	GO-bp	Annotation by Michelle Graham. GO Biological Process: lipid metabolic process	SoyBase	N/A	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0008219	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell death	SoyBase	N/A	ISS
GO:0009595	GO-bp	Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus	SoyBase	N/A	ISS
GO:0009626	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0009646	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to absence of light	SoyBase	N/A	ISS
GO:0009697	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009723	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus	SoyBase	N/A	ISS
GO:0009862	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009863	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0010310	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0031348	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response	SoyBase	N/A	ISS
GO:0031408	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxylipin biosynthetic process	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0043069	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death	SoyBase	N/A	ISS
GO:0043900	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0051607	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to virus	SoyBase	N/A	ISS
GO:0051707	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to other organism	SoyBase	N/A	ISS
GO:0071456	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to hypoxia	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016298	GO-mf	Annotation by Michelle Graham. GO Molecular Function: lipase activity	SoyBase	N/A	ISS
GO:0045735	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nutrient reservoir activity	SoyBase	N/A	ISS
PTHR10470	Panther	PATATIN-RELATED	JGI		ISS
PTHR10470:SF3	Panther	PATATIN-RELATED	JGI		ISS
PF01734	PFAM	Patatin-like phospholipase	JGI		ISS
UniRef100_G7J6A9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Patatin-like protein n=1 Tax=Medicago truncatula RepID=G7J6A9_MEDTR	SoyBase	E_val: 2.00E-122	ISS
UniRef100_I1JTH8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1JTH8_SOYBN	SoyBase	E_val: 5.00E-151	ISS

Expression Patterns of Glyma04g03970

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g03970

Paralog	Evidence	Comments
Glyma06g04130	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g03970 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g037300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g03970

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g03970

Limit To All Plant Sequences

>Glyma04g03970.1   sequence type=CDS   gene model=Glyma04g03970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAGAACATTGTCATCCCTTCTACAGATTCAGCCTCCAACCTATGGAAACTTAGTCACTATTCTCAGCATCGACGGAGGTGGTATCAGGGGCATTATCCCCGCAACTATTCTTGCTTTCCTTGAAGCGCAACTTCAGGAGTTGGACGGTGAGGATGCAAGGCTTGCAGACTATTTTGATGTGATTGCAGGAACAAGCACAGGAGGTATTGTAACAGCTATGTTAACTGCTCCAAATGATAATCAGCGTCCTCTATTTGCTGCCAAGGATATCAAGCCCTTTTACTTGGAACATTGCCCAAAGATTTTCCCACAACACAGTGGCTTGTGGGGATCGGTAGGAAAGTTGTTGAGATCATTGGGAGGACCGAAATACAATGGAAAATACCTTCAAGAAGTGGTGAGAGAGAAAGTAGGGGAGACACGTTTGCATGAAACGCTGACCAATATAGTGATTCCCACCTTTGACATCAAGACATTGCAACCAATCATTTTCTCCTCTTACCAAATAAAGAGGTCTCCTTGCTTGGATGCTCGACTCTCCGACATATGCATCAGCACTTCTGCCGCACCTACTTATCTTCCAGCCTACCACTTCAACAACAAAGATTCAGAAGGGAACATGCACCAATTCAACCTTATTGACGGTGACGAAAGAGAATTTGGAAAAACTTAG

Predicted protein sequences of Glyma04g03970

Limit To All Plant Sequences

>Glyma04g03970.1   sequence type=predicted peptide   gene model=Glyma04g03970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MERTLSSLLQIQPPTYGNLVTILSIDGGGIRGIIPATILAFLEAQLQELDGEDARLADYFDVIAGTSTGGIVTAMLTAPNDNQRPLFAAKDIKPFYLEHCPKIFPQHSGLWGSVGKLLRSLGGPKYNGKYLQEVVREKVGETRLHETLTNIVIPTFDIKTLQPIIFSSYQIKRSPCLDARLSDICISTSAAPTYLPAYHFNNKDSEGNMHQFNLIDGDEREFGKT*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain