Glyma04g03910 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g03910

Feature Type:	gene_model
Chromosome:	Gm04
Start:	2843280
stop:	2843912
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g03910

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G50060	AT	Annotation by Michelle Graham. TAIR10: myb domain protein 77 \| chr3:18558146-18559051 REVERSE LENGTH=301	SoyBase	E_val: 2.00E-57	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009723	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus	SoyBase	N/A	ISS
GO:0009751	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0048527	GO-bp	Annotation by Michelle Graham. GO Biological Process: lateral root development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
PTHR10641	Panther	MYB-RELATED	JGI		ISS
PF00249	PFAM	Myb-like DNA-binding domain	JGI		ISS
UniRef100_I1JTH1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JTH1_SOYBN	SoyBase	E_val: 2.00E-153	ISS
UniRef100_Q0PJI9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: MYB transcription factor MYB124 n=1 Tax=Glycine max RepID=Q0PJI9_SOYBN	SoyBase	E_val: 5.00E-115	ISS

Expression Patterns of Glyma04g03910

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g03910

Paralog	Evidence	Comments
Glyma06g04010	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g03910 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g036700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g03910

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g03910

Limit To All Plant Sequences

>Glyma04g03910.1   sequence type=CDS   gene model=Glyma04g03910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGAAATGAACAGAAGCTCCTCCTCCACTTCCTCTTCCTCTCACTGTTGCTCTTTAGAGTCCAACCATAGGAGCCCCAACAAGCCAGACAGAATCAAAGGCCCATGGAGCGCCCAAGAGGATCGGATCCTGACACGACTAGTCGAACAATACGGCCCTCGAAACTGGTCCCTCATCAGCCGCTACATTAAGGGCAGGTCCGGCAAATCGTGCCGGCTGCGGTGGTGCAATCAGCTGAGCCCCACCGTGGAGCACCGCCCCTTCTCGACCCAAGAGGACGAGACCATCATCGCTGCCCATGCCCGGTACGGTAACAGGTGGGCCACCATAGCCCGATTATTACCGGGCCGAACCGATAACGCCGTTAAGAACCACTGGAACTCCACGCTCAAGCGCAGAGCCAAGGGTATTAACGTTAATGTTAATGATGCCGACAACGAGGATGACCCGTTGACCGCATTGACTCTTGCTCCTCCCGGTATTGCTAATGCCACTTTGACCGAAGACGCCGTACCGGACCACCGGGCCTCGCCGGAGAGTGCGGCGGAGGGGTTTTGGGATATGATGAGGGATGTGATCGCGAGGGAAGTGAGGGAATATGTGTCTTCTAATTTTTCTGATAATAACTAG

Predicted protein sequences of Glyma04g03910

Limit To All Plant Sequences

>Glyma04g03910.1   sequence type=predicted peptide   gene model=Glyma04g03910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEEMNRSSSSTSSSSHCCSLESNHRSPNKPDRIKGPWSAQEDRILTRLVEQYGPRNWSLISRYIKGRSGKSCRLRWCNQLSPTVEHRPFSTQEDETIIAAHARYGNRWATIARLLPGRTDNAVKNHWNSTLKRRAKGINVNVNDADNEDDPLTALTLAPPGIANATLTEDAVPDHRASPESAAEGFWDMMRDVIAREVREYVSSNFSDNN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain