SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g03883

Feature Type:gene_model
Chromosome:Gm04
Start:2829138
stop:2832017
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g03883
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G80260AT Annotation by Michelle Graham. TAIR10: Spc97 / Spc98 family of spindle pole body (SBP) component | chr1:30175924-30180511 FORWARD LENGTH=995 SoyBaseE_val: 7.00E-87ISS
GO:0000226GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule cytoskeleton organization SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0000922GO-cc Annotation by Michelle Graham. GO Cellular Compartment: spindle pole SoyBaseN/AISS
GO:0005815GO-cc Annotation by Michelle Graham. GO Cellular Compartment: microtubule organizing center SoyBaseN/AISS
GO:0015631GO-mf Annotation by Michelle Graham. GO Molecular Function: tubulin binding SoyBaseN/AISS
PTHR19302Panther GAMMA TUBULIN COMPLEX PROTEIN JGI ISS
PTHR19302:SF9Panther gb def: gamma-tubulin interacting protein-like [arabidopsis thaliana] JGI ISS
PF04130PFAM Spc97 / Spc98 family JGI ISS
UniRef100_B9N3X7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Tubulin gamma complex-associated protein n=1 Tax=Populus trichocarpa RepID=B9N3X7_POPTR SoyBaseE_val: 7.00E-92ISS
UniRef100_I1K7W7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K7W7_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g03883
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g03883 not represented in the dataset
Glyma04g03883 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g03883
ParalogEvidenceComments
Glyma06g03980 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g03883 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma04g03883
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g03883
>Glyma04g03883.1   sequence type=CDS   gene model=Glyma04g03883   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTTAAACTATATGGTTTATATCCTTCTCAAAGAATGGCTGGGTTAACGTTGCCCGAAGGTTTTTCTGTATCACTAGTTGGATTTGTTGGTCATGGCGACCATGTTTGTAAGTACTTTTGGCAAAACAACTGGTATGAATCTGTATCTTTTTCTTCCAATGTATCTCATGTAAATGAGGAAAAACCAGATAATGACAATAATGAAAAATTAATTGCTCCACCTTACTCAAAAAAGACATGGTCATACATAGAAAATCAAGTTATTACTGGTTTAAGAAAGGCTATATTTGGTGGAGAAAATGCTGCATTTTCTGATAGTGAAGGAATGAACTATACTTTTGGCTTTCACTTTGGTGAATCTGAATACCTTCGCTCACAGGATGACAGAAAGCTGTTAGAAATGTTGTTTCCTTTTCCCACTATATTGCCTTTGTTTCAGAGAAACAGCAGTCTTATTTCAAGAGTTCTTCATTGGATGCAAAATGTTGACCTAAGAACTACTCCACTTCCTCTGGTTATTATGCAGTACTGCCTAACCGTCTACATTCAGAAGCAGAGAACAGGTGTTGATATTTTGTCTTGTGCAGGTGATTTGCTGCAACACTTTTTGACTGTAATTTTCAACAAGTTGGATAAGGGTGAAGCATGGGATGATGATTTTGAGTTAAACACAACATTACAGGAATCAATCAGAAATTCTGCTGATTGTATGCTGTTAAGTGCTCCAGACTCATTGGTAGTGTCGATAACCAAAAATCATGTTGACAGTGATGAGGAAGCTAGCACAGCTGGTGTTGTTTTGAGTACGCCTCCTCAAAGTCATGTCAATAGCTTTGGAATTAATGGCCTTGATATGCTCAAATTCACGTATAGGGTTCCTTGGCCTCTTGAACTCATTGCAAATACTGAGGCAATTAAGAAGTACAACCAGGTGATGCGGTTCTTGTTGAAGGTCAAGCGTGCAAAATTTGTATTAGATAAAGTGCGGAGATGGAAGTGGAAGGTGCTTCCATAG
Predicted protein sequences of Glyma04g03883
>Glyma04g03883.1   sequence type=predicted peptide   gene model=Glyma04g03883   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFKLYGLYPSQRMAGLTLPEGFSVSLVGFVGHGDHVCKYFWQNNWYESVSFSSNVSHVNEEKPDNDNNEKLIAPPYSKKTWSYIENQVITGLRKAIFGGENAAFSDSEGMNYTFGFHFGESEYLRSQDDRKLLEMLFPFPTILPLFQRNSSLISRVLHWMQNVDLRTTPLPLVIMQYCLTVYIQKQRTGVDILSCAGDLLQHFLTVIFNKLDKGEAWDDDFELNTTLQESIRNSADCMLLSAPDSLVVSITKNHVDSDEEASTAGVVLSTPPQSHVNSFGINGLDMLKFTYRVPWPLELIANTEAIKKYNQVMRFLLKVKRAKFVLDKVRRWKWKVLP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo