SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g03740

Feature Type:gene_model
Chromosome:Gm04
Start:2735598
stop:2737768
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g03740
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G42650AT Annotation by Michelle Graham. TAIR10: allene oxide synthase | chr5:17097803-17099359 REVERSE LENGTH=518 SoyBaseE_val: 0ISS
GO:0000096GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur amino acid metabolic process SoyBaseN/AISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006546GO-bp Annotation by Michelle Graham. GO Biological Process: glycine catabolic process SoyBaseN/AISS
GO:0006569GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0006733GO-bp Annotation by Michelle Graham. GO Biological Process: oxidoreduction coenzyme metabolic process SoyBaseN/AISS
GO:0006766GO-bp Annotation by Michelle Graham. GO Biological Process: vitamin metabolic process SoyBaseN/AISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0008652GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process SoyBaseN/AISS
GO:0009072GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family metabolic process SoyBaseN/AISS
GO:0009106GO-bp Annotation by Michelle Graham. GO Biological Process: lipoate metabolic process SoyBaseN/AISS
GO:0009108GO-bp Annotation by Michelle Graham. GO Biological Process: coenzyme biosynthetic process SoyBaseN/AISS
GO:0009117GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide metabolic process SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009620GO-bp Annotation by Michelle Graham. GO Biological Process: response to fungus SoyBaseN/AISS
GO:0009684GO-bp Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process SoyBaseN/AISS
GO:0009694GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid metabolic process SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0015994GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll metabolic process SoyBaseN/AISS
GO:0019216GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of lipid metabolic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019373GO-bp Annotation by Michelle Graham. GO Biological Process: epoxygenase P450 pathway SoyBaseN/AISS
GO:0019748GO-bp Annotation by Michelle Graham. GO Biological Process: secondary metabolic process SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0031407GO-bp Annotation by Michelle Graham. GO Biological Process: oxylipin metabolic process SoyBaseN/AISS
GO:0031408GO-bp Annotation by Michelle Graham. GO Biological Process: oxylipin biosynthetic process SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0044272GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur compound biosynthetic process SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0010287GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastoglobule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005506GO-mf Annotation by Michelle Graham. GO Molecular Function: iron ion binding SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
GO:0009978GO-mf Annotation by Michelle Graham. GO Molecular Function: allene oxide synthase activity SoyBaseN/AISS
GO:0016705GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen SoyBaseN/AISS
GO:0016836GO-mf Annotation by Michelle Graham. GO Molecular Function: hydro-lyase activity SoyBaseN/AISS
GO:0019825GO-mf Annotation by Michelle Graham. GO Molecular Function: oxygen binding SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
KOG0159 KOG Cytochrome P450 CYP11/CYP12/CYP24/CYP27 subfamilies JGI ISS
PF00067PFAM Cytochrome P450 JGI ISS
UniRef100_A0MAV5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Allene oxide synthase n=1 Tax=Glycine max RepID=A0MAV5_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1JTE7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JTE7_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g03740
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g03740 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g035000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g03740
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g03740
>Glyma04g03740.1   sequence type=CDS   gene model=Glyma04g03740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACATCAATTACCTCTGCATCCCTTCCTTTGCTGCAACTCCAATCTTCATTGAAGAGAAAACCCTGCAACTTGAAGAGCTCCACCACCATGCGTCGTTTTACAACCAAAGCCTCAGCCTCTGAAACGACGTCGGCGGCTGCGCCAGCGCCCGAGCCCAGCAAGCTTCCCATGCGAAAGATCCCAGGAGATTACGGTCTCCCTTTCATAGGACCCATCAAAGACCGCCTTGACTTCTTCTACAACCAAGGGCGCGACAAGTTCTTCCAATCCCGCGCCCAAAAATACAACTCCACCGTGTTCCGCGCCAACATGCCCCCCGGCCCCTTCATCGCCTCCAATCCAAACGTCATCGTTTTGCTCGACGCCAAAAGCTTCCCTGTCCTTTTCGACGTCAGCAAAGTCGAAAAGCGTGACGTCTTCACCGGCACCTTCATGCCCTCCACCCAACTCACCGGCGGTTACCGAATCCTCTCCTACCTGGACCCCTCCGAACCCAGACACGAACAACTCAAGCGCCTCTTGTTCTTCCTCCTCAAATCCCGAAGCAGCCACGTCATCCCCGAGTTTCATTCAAGCTACACAACCCTCTTTGAAACCCTGGAGAATGAGCTTGCTAAGGAAGGCAAGGCTAGCTTCCAAACCGCCAACGACCAAGCTGCGTTTAACTTCCTCGCTCGCGCGCTTTATGGCACCAACCCCTCCGACACAAACCTCGGACGCGACGGCCCAAGCATAATCCAAACATGGCTTTTGTTCCAGCTCGGCCCAATTATGACCTTGGGCCTTCCAAAATTCCTGGAAGATCCCACTCTTCACACCTTCCGCATCCCTCCTTTTCTGATAAAAAAAGATTACAAGAGACTCTACGATTTCTTCTACGAGTCCTCCGGGTTCGCGCTTGACGAAGCGGTGCGTTTAGGAGTTCCCAGAGAAGAAGCGTGCCACAACCTTTTATTCGCCACGTGCTTTAATTCCTTCGGGGGAATGAAGATATTCTTCCCCACTATTCTGAAATGGGTTGGGCGTGCGGGGGTGAAACTTCACGCTAGGTTGGCGGAGGAAGTGAGGGCCGCCGTTAAGTCAAACGGCGGGAAGGTGACGATGGCGTCGATGGAGGAAATGCCGTTGATGAAGTCGGTGGTTTACGAGGCGTTTCGGATAGAGCCGCCAGTGCCGCTGCAGTACGGGAGGGCGAAGAAGGAGTTGGTGATTGAGAGCCACGAGAATGCGTTCGTGGTGAAGGAAGGGGAGATGCTGTTCGGGTTTCAGCCGTTTGCGACAAAGGATCCGAAGATATTTGAGAATGCGGAGGAATTTGTGGCGGATCGGTTTGTGGGGGAGGGAGAGAAGTTGCTCAAACACGTGCTTTGGTCCAATGGGCCTGAGACCGAGGGACCCACCCTTGGGAACAAGCAATGTGCAGGGAAGGATTTTGTGGTGTTGTTCTCTCGGCTTCTGGTGGTGGAGTTCTTTCTTCATTATGATTCCTTTGATGTCCAAGTGGGGAATTCATCTTTGGGTTCTTCCCTTACCTTCACCTCCCTCAAGAAAGCAAGCTATTAG
Predicted protein sequences of Glyma04g03740
>Glyma04g03740.1   sequence type=predicted peptide   gene model=Glyma04g03740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTSITSASLPLLQLQSSLKRKPCNLKSSTTMRRFTTKASASETTSAAAPAPEPSKLPMRKIPGDYGLPFIGPIKDRLDFFYNQGRDKFFQSRAQKYNSTVFRANMPPGPFIASNPNVIVLLDAKSFPVLFDVSKVEKRDVFTGTFMPSTQLTGGYRILSYLDPSEPRHEQLKRLLFFLLKSRSSHVIPEFHSSYTTLFETLENELAKEGKASFQTANDQAAFNFLARALYGTNPSDTNLGRDGPSIIQTWLLFQLGPIMTLGLPKFLEDPTLHTFRIPPFLIKKDYKRLYDFFYESSGFALDEAVRLGVPREEACHNLLFATCFNSFGGMKIFFPTILKWVGRAGVKLHARLAEEVRAAVKSNGGKVTMASMEEMPLMKSVVYEAFRIEPPVPLQYGRAKKELVIESHENAFVVKEGEMLFGFQPFATKDPKIFENAEEFVADRFVGEGEKLLKHVLWSNGPETEGPTLGNKQCAGKDFVVLFSRLLVVEFFLHYDSFDVQVGNSSLGSSLTFTSLKKASY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo