SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g03270

Feature Type:gene_model
Chromosome:Gm04
Start:2407796
stop:2412282
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g03270
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G66460AT Annotation by Michelle Graham. TAIR10: Glycosyl hydrolase superfamily protein | chr5:26538911-26540837 REVERSE LENGTH=431 SoyBaseE_val: 0ISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009944GO-bp Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010075GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004553GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds SoyBaseN/AISS
GO:0043169GO-mf Annotation by Michelle Graham. GO Molecular Function: cation binding SoyBaseN/AISS
PF00150PFAM Cellulase (glycosyl hydrolase family 5) JGI ISS
UniRef100_E5GCI6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Endo-beta-mannanase n=1 Tax=Cucumis melo subsp. melo RepID=E5GCI6_CUCME SoyBaseE_val: 0ISS
UniRef100_I1JT90UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JT90_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g03270
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g03270
ParalogEvidenceComments
Glyma06g03350 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g03270 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g030400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g03270
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g03270
>Glyma04g03270.1   sequence type=CDS   gene model=Glyma04g03270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGAGCGTCGTCTTTTGGTTCTCTGGTCTCTATGTCACAGTGGAGTTCTACGTAGAAGCAGATGGTAGTGGTGGGTTTGTGAGAACAAGAGGAGTGCAGCTTATGCTGAATGGGAGCCCCTACTATGCTAATGGCTTTAATGCCTATTGGCTAATGTATCTTGCCTCTGATCCTTCTCAGAGAAACAAAGTCTCATCAGTGTTTCAACAGGCTTCAAATCATGGCCTCAACATTGCCAGAACTTGGGCTTTCAGTGATGGTGGATATCAACCACTACAATACTCTCCTGGATCTTACAATTACCAAATGTTTCAGGGATTGGATTTTGCAATAGCCGAAGCAAGAAAATATGGGATCAAGATGGTGTTGAGTTTGGTGAATAACTATGAGAACATGGGTGGGAAGAAGCAATATGTGGAATGGGCAAAGAGTCAGGGGCAGTCCATAAATTCTGAGGATGACTTTTTCACAAATCCTGTTGTGAAGGGATACTACAAAAACCACATCAAGGCTGTACTTACAAGACGTAATAGCATCACTGGAGTTGCTTACAAAGACGACCCAACTATAATGGCTTGGGAACTTATGAATGAGATTAGGTGCCCTTCTGATCAATCAGGAAGGACAGTTCAGGCTTGGATCACTGAGATGGCATCTTACCTGAAATCCATAGATGGAAACCACTTGCTGGAAGCTGGTCTGGAGGGTTTCTACGGCCAGTCAAAGCCTCAGTCTAACCCAAACTTCAATGTAGGAACCGATTTCATTGCCAACAACCAAATCCCAGGCATTGATTTCGCAACAGTGCACTCCTACCCGGACCAATGGCTATCAAGTTCTAGTTATGAGGACCAAATCTCATTTTTAGGCCGTTGGCTGGATGAGCACATCCAAGATGCACAGAACACCCTTCACAAGCCACTTCTATTTGCGGAGTTTGGTATTTCCACAAAGAGTTATGGTGGCAACTCAACACCAAGGGATCGGTTATTCAACACAGTATATTCTGCAATATACTCATCAGCAAGCAGTGGCGGGGCTGCTGTTGGTGGCTTGTTTTGGCAACTTATGGTTCAAGGAATGGATTCTTATCGAGACGGTTACGAAGTTGTCTTAGATGAGAGCCCTTCAACGGCTAATTTGATCGCTCAAGAGTCTCAAAAACTAAACCGAATTCGCAAGATGTACGCCAGACTTAGAAACATTGAGAAGTGGAATGAAGCTAAGCAAATTAGAGGTGGAAACTGA
Predicted protein sequences of Glyma04g03270
>Glyma04g03270.1   sequence type=predicted peptide   gene model=Glyma04g03270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMSVVFWFSGLYVTVEFYVEADGSGGFVRTRGVQLMLNGSPYYANGFNAYWLMYLASDPSQRNKVSSVFQQASNHGLNIARTWAFSDGGYQPLQYSPGSYNYQMFQGLDFAIAEARKYGIKMVLSLVNNYENMGGKKQYVEWAKSQGQSINSEDDFFTNPVVKGYYKNHIKAVLTRRNSITGVAYKDDPTIMAWELMNEIRCPSDQSGRTVQAWITEMASYLKSIDGNHLLEAGLEGFYGQSKPQSNPNFNVGTDFIANNQIPGIDFATVHSYPDQWLSSSSYEDQISFLGRWLDEHIQDAQNTLHKPLLFAEFGISTKSYGGNSTPRDRLFNTVYSAIYSSASSGGAAVGGLFWQLMVQGMDSYRDGYEVVLDESPSTANLIAQESQKLNRIRKMYARLRNIEKWNEAKQIRGGN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo