SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g03100

Feature Type:gene_model
Chromosome:Gm04
Start:2255626
stop:2258223
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g03100
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G75460AT Annotation by Michelle Graham. TAIR10: ATP-dependent protease La (LON) domain protein | chr1:28327986-28328822 FORWARD LENGTH=278 SoyBaseE_val: 9.00E-122ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0004176GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP-dependent peptidase activity SoyBaseN/AISS
KOG4159 KOG Predicted E3 ubiquitin ligase JGI ISS
PTHR23327Panther UNCHARACTERIZED JGI ISS
PF02190PFAM ATP-dependent protease La (LON) domain JGI ISS
UniRef100_B9R814UniRef Annotation by Michelle Graham. Most informative UniRef hit: ATP-dependent peptidase, putative n=1 Tax=Ricinus communis RepID=B9R814_RICCO SoyBaseE_val: 6.00E-143ISS
UniRef100_I1JT74UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JT74_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g03100
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g03100
ParalogEvidenceComments
Glyma06g03140 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g03100 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g028400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g03100
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g03100
>Glyma04g03100.1   sequence type=CDS   gene model=Glyma04g03100   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTTCACACAGCTTATCCCTTCACCTTCTTCTTCCTCCTTAAACCCTATCACACTCTCCCTAAACCCTAAATCCCCAACCTCTCCGCCGCAGCAGCATTTCAATCTCGATATTCTCCGGCACCGGCGCCGGAGGCCTAATTCCACTCTTCGGTGCTCCGCCTCCTCGTTCTCGGAGAAGCACCACACGAACTCCTCGAACTCCGACGACGTGGTGGAGCTCCCCCTGTTCCCTCTCCCTCTGGTCCTCTTCCCTGGCGCCATCCTCCCCTTGCAGATCTTCGAGTTCCGCTACCGCATCATGATGCACACGCTCCTCCACACCGACCTACGCTTCGGCATCATCTACACCGACGCCGTCTCTGGAACCGCCGAGGTCGGCTGCGTCGGCGAAGTCATCAAGCACGAGCGCCTCGTCGACGACCGGTTCTTCCTCATCTGCAAGGGGCAAGAGCGGTTCCGCGTGAATGGTGTTGTCCGCACCAAACCCTACCTCGTCGCGCAGGTGACGTGGCTCGAGGACCGCCCTTCTCCCTCCACCGACCTCGATCTCGACGGTCTCGCCACCGAAGTGGAGACCTATATGAAAGACGTTATCCGGTTATCGAACCGGTTGGGAGGGAAACCGGAGAAGGAGGTTGGGGATTTGAGACGAAACCTCTTTCCCACGCCGTTTTCGTTTTTCGTTGGGAGCACCTTTGAGGGCGCGCCTAGGGAGCAACAAGCGCTGCTTGAATTGGAGGACACTGCGGCCAGATTGAAGAGGGAGAAGGAAACGTTGAAGAACACGCTTAATTACCTCACTGCTGCTTCTGCTGTTAAAGACGTTTTTCCCTCTTCTTCCAATTCTTCTTGA
Predicted protein sequences of Glyma04g03100
>Glyma04g03100.1   sequence type=predicted peptide   gene model=Glyma04g03100   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAFTQLIPSPSSSSLNPITLSLNPKSPTSPPQQHFNLDILRHRRRRPNSTLRCSASSFSEKHHTNSSNSDDVVELPLFPLPLVLFPGAILPLQIFEFRYRIMMHTLLHTDLRFGIIYTDAVSGTAEVGCVGEVIKHERLVDDRFFLICKGQERFRVNGVVRTKPYLVAQVTWLEDRPSPSTDLDLDGLATEVETYMKDVIRLSNRLGGKPEKEVGDLRRNLFPTPFSFFVGSTFEGAPREQQALLELEDTAARLKREKETLKNTLNYLTAASAVKDVFPSSSNSS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo