SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g03011

Feature Type:gene_model
Chromosome:Gm04
Start:2188000
stop:2194815
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g03011
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G39080AT Annotation by Michelle Graham. TAIR10: vacuolar proton ATPase A3 | chr4:18209513-18214752 FORWARD LENGTH=821 SoyBaseE_val: 0ISS
GO:0000902GO-bp Annotation by Michelle Graham. GO Biological Process: cell morphogenesis SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007033GO-bp Annotation by Michelle Graham. GO Biological Process: vacuole organization SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0015986GO-bp Annotation by Michelle Graham. GO Biological Process: ATP synthesis coupled proton transport SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0031669GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to nutrient levels SoyBaseN/AISS
GO:0032119GO-bp Annotation by Michelle Graham. GO Biological Process: sequestering of zinc ion SoyBaseN/AISS
GO:0043181GO-bp Annotation by Michelle Graham. GO Biological Process: vacuolar sequestering SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0070072GO-bp Annotation by Michelle Graham. GO Biological Process: vacuolar proton-transporting V-type ATPase complex assembly SoyBaseN/AISS
GO:0000325GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009705GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole membrane SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0009678GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrogen-translocating pyrophosphatase activity SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0045735GO-mf Annotation by Michelle Graham. GO Molecular Function: nutrient reservoir activity SoyBaseN/AISS
KOG2189 KOG Vacuolar H+-ATPase V0 sector, subunit a JGI ISS
PTHR11629Panther VACUOLAR PROTON ATPASES JGI ISS
PTHR11629:SF11Panther VACUOLAR PROTON ATPASE JGI ISS
PF01496PFAM V-type ATPase 116kDa subunit family JGI ISS
UniRef100_E6NU69UniRef Annotation by Michelle Graham. Most informative UniRef hit: JHL18I08.13 protein n=1 Tax=Jatropha curcas RepID=E6NU69_9ROSI SoyBaseE_val: 0ISS
UniRef100_I1JT64UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JT64_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g03011
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g03011 not represented in the dataset
Glyma04g03011 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g03011
ParalogEvidenceComments
Glyma06g03040 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g03011 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g027500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g03011
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g03011
>Glyma04g03011.1   sequence type=CDS   gene model=Glyma04g03011   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCACGTAGGCTACGGTTGTTTAAGGAACAAATGACGAAAGCAGGTGTATCTCCCTCAATGTGGTCAACAAGAGACGATCATTTTGATCTGGAACATTTGGAGGTTAAACTTGAAGAACTTGAAGCTGAGCTCCTCGAGATTAATGCAAATAATGAGAAGTTGCAGCACACTTACAATGAGCTATTAGAGTATAAGCTTGTTCTAGAGAAGGTTGGTGAGCTTTTCTCTTCAGCAAAAAATAAGGCTGTAGCTCACCAGAAAGAGCTTGAATTTCAGACAACTGTTGAAGGGTCTATTGACAGTCCATTATTATTGGAACAAGAGGAGACGACAACAAAGCAAATTAAGCTGGGGTTTATTGGTGGACTTGTTCATAGGGAAAAATCAATTCCTTTCGAAAGAATTATATTTCGTGCTGCTAGGGGAAATCTGTTTCTCAAACAGGGTGTGATTGAACATCCTGTTCTTGATCCTTTGTCAGGAGAGATGGTTCATAAAAACGTATTTGTTGTCTTTTATTCCGGAGAAAGAGTTAAAAGTAAAATTCTGAAAATATGTGATGCTTTTGGAGCAAATCGTTATGCTTTCTCAAATGACTCGAGTAAACAATTTCAGACGATAAGAGAGGTTTCTGGAAGAATTTCAGAATTGAAGGCTACCATTGATGCAGCGTTGATTCACCGGAGCACTCTATTGCAGACAATTGGATATCACCATGGGCAGTGGAGGCTTCTGATTCACAAAGTATTGCAGCGGGCAACTATGGACTGCAGTTCTCAAGTTGTGGCGATATTCCAGGTTTTAGAGACAACGGAATCACCACCTACCTATTTTTGCACAAACAAATTCACTTCTTCTTTCCAAGAAATTGTTGATGCCTATGGAATCGCCAAGTACCAGGAAGCAAATCCCGGTGTATACACAGTTGTCACGTTTCCATTCCTTTTTGCCGTAATGTTTGGTGACTGGGGGCATGGCATATGCTTATTACTGGCGGCTTTGTATTTAATGATCAGAGAGAGAAAATTTGCTAGTCAGAAACTTGGAGACATAATGGAAATGGCATTCGGCGGACGCTATATTATTATGATGATGGCCCTCTTCTCAATCTATACCGGGGATGCTTCTACAACAGGTTTCATAAAAGTGCGTAGCACTTATCCATTTGGCGTGGATCCTAAATGCCATGGTACTCGGAGTGAACTGCCATTTCTTAATTCTTTGAAGATGAAGATGTCAATTCTGCTGGGGGTATCCCAGATGAACCTTGGAATCATAATGAGTTACTTTAATGCAAAATACTTCAAAAACAACATAAATATCTGGTACCAGTTCGTTCCCCAGATAATATTCTTAAACAGCTTGTTTGGCTATCTTTCACTCCTCATAATTATAAAATGGAGCACTGGGTCGCAGGCTGACCTGTATCATCTGATGATATACACGTTCCTAAGCCCAACTGATGATTTGGGTGAAAACCAGCTTTTCGTTGGTCAAAAGCTCCTTCAACTCGTGTTACTACTGTTGGCAGTTGTTGCTGTGCCATGGATGCTACTACCAAAGCCCTTTCTCCTGAAGAAGCAACATCAAGAAAGGCATCAAGGCCAATCTTACGATTTGCTCTGCGGCACCGATGACACTCTTGAATCAGAATCACAAAGTATTGCCCATGACCATGACGAGTTTGACTTCAGCGAGGTTTTTGTGCACCAACTTATACATACAATAGAATTTGTGCTTGGAGCTGTTTCTAACACGGCATCGTCTCTACGTTTGTGGGCCCTCAGTTGA
Predicted protein sequences of Glyma04g03011
>Glyma04g03011.1   sequence type=predicted peptide   gene model=Glyma04g03011   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MARRLRLFKEQMTKAGVSPSMWSTRDDHFDLEHLEVKLEELEAELLEINANNEKLQHTYNELLEYKLVLEKVGELFSSAKNKAVAHQKELEFQTTVEGSIDSPLLLEQEETTTKQIKLGFIGGLVHREKSIPFERIIFRAARGNLFLKQGVIEHPVLDPLSGEMVHKNVFVVFYSGERVKSKILKICDAFGANRYAFSNDSSKQFQTIREVSGRISELKATIDAALIHRSTLLQTIGYHHGQWRLLIHKVLQRATMDCSSQVVAIFQVLETTESPPTYFCTNKFTSSFQEIVDAYGIAKYQEANPGVYTVVTFPFLFAVMFGDWGHGICLLLAALYLMIRERKFASQKLGDIMEMAFGGRYIIMMMALFSIYTGDASTTGFIKVRSTYPFGVDPKCHGTRSELPFLNSLKMKMSILLGVSQMNLGIIMSYFNAKYFKNNINIWYQFVPQIIFLNSLFGYLSLLIIIKWSTGSQADLYHLMIYTFLSPTDDLGENQLFVGQKLLQLVLLLLAVVAVPWMLLPKPFLLKKQHQERHQGQSYDLLCGTDDTLESESQSIAHDHDEFDFSEVFVHQLIHTIEFVLGAVSNTASSLRLWALS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo