SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g02271

Feature Type:gene_model
Chromosome:Gm04
Start:1577466
stop:1578977
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g02271
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G20330AT Annotation by Michelle Graham. TAIR10: sterol methyltransferase 2 | chr1:7038968-7040053 REVERSE LENGTH=361 SoyBaseE_val: 0ISS
GO:0006007GO-bp Annotation by Michelle Graham. GO Biological Process: glucose catabolic process SoyBaseN/AISS
GO:0006084GO-bp Annotation by Michelle Graham. GO Biological Process: acetyl-CoA metabolic process SoyBaseN/AISS
GO:0006694GO-bp Annotation by Michelle Graham. GO Biological Process: steroid biosynthetic process SoyBaseN/AISS
GO:0007389GO-bp Annotation by Michelle Graham. GO Biological Process: pattern specification process SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0016126GO-bp Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process SoyBaseN/AISS
GO:0016132GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0032876GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of DNA endoreduplication SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0008168GO-mf Annotation by Michelle Graham. GO Molecular Function: methyltransferase activity SoyBaseN/AISS
GO:0008757GO-mf Annotation by Michelle Graham. GO Molecular Function: S-adenosylmethionine-dependent methyltransferase activity SoyBaseN/AISS
KOG1269 KOG SAM-dependent methyltransferases JGI ISS
PTHR10108Panther METHYLTRANSFERASE JGI ISS
PTHR10108:SF21Panther S-ADENOSYL-L-METHIONINE:DELTA24-STEROL-C-METHYLTRANSFERASE JGI ISS
PF08241PFAM Methyltransferase domain JGI ISS
PF08498PFAM Sterol methyltransferase C-terminal JGI ISS
UniRef100_D2D5G3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Sterol 24-C methyltransferase 2-1 n=1 Tax=Glycine max RepID=D2D5G3_SOYBN SoyBaseE_val: 0ISS
UniRef100_D2D5G3UniRef Annotation by Michelle Graham. Best UniRef hit: Sterol 24-C methyltransferase 2-1 n=1 Tax=Glycine max RepID=D2D5G3_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g02271
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g02271 not represented in the dataset
Glyma04g02271 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g02271
ParalogEvidenceComments
Glyma06g02330 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g02271 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g020600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g02271
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g02271
>Glyma04g02271.1   sequence type=CDS   gene model=Glyma04g02271   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGACCCCCTCTCTCTCTTCTGCACCGGAGCCCTCCTCGCCGGCGGCCTCTACTGGTTCGTGTGCGTTCTGGGCCCCGCCGAGCAGAAGGGCAAACGCGCCACCGATCTTTCCGGCGGCTCCATCTCCGCCGAGAAAGTCCAAGACAACTACAAACAGTACTGGTCCTTCTTCCGCCGCCCAAAGGAGATCGAGACCGCCGACAAAGTCCCCGACTTCGTCGACACCTTCTACAATCTAGTCACAGACATCTACGAGTGGGGGTGGGGCCAGTCCTTCCACTTCTCCCCCTCCATCCCCGGCAAGTCCCACCGCGACGCCACGCGCCTCCACGAGGAGATGGCCGTCGATCTCATCGAGGCCAAGCCCGGCAACAGAATCCTGGATGTGGGCTGTGGCGTGGGCGGTCCCATGCGGGCCATCGCGGCCCACTCGCGGGCCAACGTAGTCGGCATCACCATCAACGAGTACCAGGTCAACCGCGCAAGGATGCACAACAAGAAGGCAGGGTTGGAGTCCCTCTGCGAGGTCGTGTGCGGGAATTTTCTCAAGATGCCCTTCCCCGACAACAGCTTCGACGGCGCGTACTCCATCGAGGCCACGTGTCACGCGCCGAAGCTGGAGGAAGTGTACGCCGAAATCTTCCGTGTTCTGAAACCGGGGGCGCTCTATGTTTCCTACGAGTGGGTGACGACGGATAAGTACCGAGGCGATGACCCTGAACACGTGGAGGTCATTCAGGGGATTGAGAGGGGGGACGCGTTGCCTGGCCTTAGAAACTACACCGACATAGCCGAGACGGCGCGTAAGGTAGGGTTTGCTGTTGTGAAGGAGCGGGATCTGGCTAAGCCGCCGGCTCAGCCATGGTGGAGCCGATTGAAGATGGGTAGGATCGCCTACTGGCGGAACCATATTGTGGTCACTGTTCTCGCCGCTTTGGGAATCGCGCCCAAGGGGACCGTCGATGTTCATGAGATGCTCTTCAAGACCGCTGACTATTTGACCAGAGGGGGTGACTCTGGCATTTTCTCGCCGATGCACATGATCCTCTGCAGAAAGCCCCATGACAAGGACGACCATAACTGA
Predicted protein sequences of Glyma04g02271
>Glyma04g02271.1   sequence type=predicted peptide   gene model=Glyma04g02271   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDPLSLFCTGALLAGGLYWFVCVLGPAEQKGKRATDLSGGSISAEKVQDNYKQYWSFFRRPKEIETADKVPDFVDTFYNLVTDIYEWGWGQSFHFSPSIPGKSHRDATRLHEEMAVDLIEAKPGNRILDVGCGVGGPMRAIAAHSRANVVGITINEYQVNRARMHNKKAGLESLCEVVCGNFLKMPFPDNSFDGAYSIEATCHAPKLEEVYAEIFRVLKPGALYVSYEWVTTDKYRGDDPEHVEVIQGIERGDALPGLRNYTDIAETARKVGFAVVKERDLAKPPAQPWWSRLKMGRIAYWRNHIVVTVLAALGIAPKGTVDVHEMLFKTADYLTRGGDSGIFSPMHMILCRKPHDKDDHN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo