SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g02210

Feature Type:gene_model
Chromosome:Gm04
Start:1522096
stop:1524613
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g02210
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G76110AT Annotation by Michelle Graham. TAIR10: HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain | chr1:28555287-28557465 REVERSE LENGTH=338 SoyBaseE_val: 3.00E-133ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006333GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin assembly or disassembly SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
KOG0381 KOG HMG box-containing protein JGI ISS
PTHR13711Panther SWI/SNF-RELATED CHROMATIN BINDING PROTEIN JGI ISS
PTHR13711:SF39Panther HIGH MOBILITY GROUP PROTEIN HMG-2A,4 JGI ISS
PF00505PFAM HMG (high mobility group) box JGI ISS
PF01388PFAM ARID/BRIGHT DNA binding domain JGI ISS
UniRef100_B9H5D3UniRef Annotation by Michelle Graham. Most informative UniRef hit: High mobility group family n=2 Tax=Populus trichocarpa RepID=B9H5D3_POPTR SoyBaseE_val: 1.00E-155ISS
UniRef100_I1JSY3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JSY3_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g02210
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g02210 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g020000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g02210
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g02210
>Glyma04g02210.1   sequence type=CDS   gene model=Glyma04g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCATCGGCGGCGAGAACTCCCGGTGGCGAGGAGGGAAAGCACTACCCTGCTCCACTCGCCCCTCACGAGGGCGTCGTGAAGGACTCCACTCTCTTCTGGGACACTCTAAGGCGCTTTCACTTTGTTATGGGTACCAAATTTATGATTCCTGTGATTGGAGGGAAGGAGCTGGATTTGCACGTTCTTTACGTGGAAGTTACGAGAAGAAGTGGCTACGAGAAGGTAGTTGCAGAGAAGAAGTGGAGGGAAGTTGGTAGTGTTTTCAAGTTCGCAGCTACCACCACCAGCGCTTCTTTTGTACTCAGGAAACACTACTTTAGTCTTCTTTATCATTATGAACAAGTTCACTTCTTTAAAGCTCGGGGTCCTATCTACACTCCATCAGCAGATGCATTTTCCGGCAACAGCCCTTCGTGGAGACCTGAATTAGCTATTGTGGAATATTCGCCTAAGCCTATGGATAATAGTCCTGAATCTCGTGCTGAAGATACTTCATGCCTTTCAGGAAATGGAACCATCGAGGGAAAATTTGACTGTGGTTATTTAGTGTCCGTGAAGCTTGGTTCGGAGGTTCTTAGAGGGGTGCTTTACCATCCTGAGCAATTGGTTCCTCCACCATCGATTCCAAAACATGAGAGTGCCATTGTACCAATCAACCGCAAACCTCACCGTTCTGGTCGTAGGAAGAAAAACAAAAGAAGGTGGGACCCCAATTATCCAAAGCCGAATAGGAGTGGCTATAACTTCTTCTTTGCTGAAAAGCATTACACTCTCAAAACTCTCTACCCAAACAGAGAAAGGGAGTTTACCAAAATGATTGGCCAGTCATGGAACAGTCTTAGCCCAGAAGAAAGAATGGTTTATCAGAACATTGGCTTAAGAGACAAAGAAAGGTACAAGAGAGAATTGACGGAGTACAAAGAGAAGATGAAGCTTAGGCAGACCTCAGAAGTTGGACGTCCATAG
Predicted protein sequences of Glyma04g02210
>Glyma04g02210.1   sequence type=predicted peptide   gene model=Glyma04g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSAARTPGGEEGKHYPAPLAPHEGVVKDSTLFWDTLRRFHFVMGTKFMIPVIGGKELDLHVLYVEVTRRSGYEKVVAEKKWREVGSVFKFAATTTSASFVLRKHYFSLLYHYEQVHFFKARGPIYTPSADAFSGNSPSWRPELAIVEYSPKPMDNSPESRAEDTSCLSGNGTIEGKFDCGYLVSVKLGSEVLRGVLYHPEQLVPPPSIPKHESAIVPINRKPHRSGRRKKNKRRWDPNYPKPNRSGYNFFFAEKHYTLKTLYPNREREFTKMIGQSWNSLSPEERMVYQNIGLRDKERYKRELTEYKEKMKLRQTSEVGRP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo