SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g01651

Feature Type:gene_model
Chromosome:Gm04
Start:1095869
stop:1098806
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g01651
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G76420AT Annotation by Michelle Graham. TAIR10: NAC (No Apical Meristem) domain transcriptional regulator superfamily protein | chr1:28672029-28673835 REVERSE LENGTH=334 SoyBaseE_val: 6.00E-93ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007275GO-bp Annotation by Michelle Graham. GO Biological Process: multicellular organismal development SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010073GO-bp Annotation by Michelle Graham. GO Biological Process: meristem maintenance SoyBaseN/AISS
GO:0010199GO-bp Annotation by Michelle Graham. GO Biological Process: organ boundary specification between lateral organs and the meristem SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
PF02365PFAM No apical meristem (NAM) protein JGI ISS
UniRef100_G7J6G2UniRef Annotation by Michelle Graham. Most informative UniRef hit: NAC domain-containing protein n=1 Tax=Medicago truncatula RepID=G7J6G2_MEDTR SoyBaseE_val: 5.00E-127ISS
UniRef100_UPI000233976AUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233976A related cluster n=1 Tax=unknown RepID=UPI000233976A SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g01651
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g01651 not represented in the dataset
Glyma04g01651 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g01651
ParalogEvidenceComments
Glyma06g01741 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g01651 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g014900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g01651
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g01651
>Glyma04g01651.1   sequence type=CDS   gene model=Glyma04g01651   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTGGCAATGGAAGAGCTACTGTGTGAACTTAGTGATCATGAAAAGAGAAACGAGCAAGGTCTGCCCCCGGGTTTCAGGTTTCACCCCACTGATGAAGAACTTATAACCTTTTACTTGGCTTCTAAGGTCTTTAATGACACTTTCTCTAACCTCAAGTTTGCTGAGGTTGACCTCAATAGATGTGAGCCTTGGGAACTTCCAGATGTGGCAAAGATGGGGGAGAGAGAATGGTATCTGTTCAGCTTGAGGGACAGAAAATACCCAACTGGACTAAGAACAAACAGAGCAACCGGAGCTGGGTACTGGAAAGCCACTGGGAAGGACAAGGAAGTGTACAGTGCATCCAGTGGAACCCTACTTGGAATGAAGAAGACCCTTGTTTTCTACAAAGGCAGGGCCCCTCGTGGTGAAAAGACCAAATGGGTCATGCACGAGTACCGTTTGGACGCTCACTTTTCCCTTCCCCATACTTACCCATCTAAGGAGGAGTGGGTGATATGCAGGATATTTCATAAATCTGGGGAAAAGAGAACTCCAGTGCTCCAAGTCCAAGGACATTCAGATGCTTCTTCGTCCCCAATAAAAAGTTCTTTATCTCCATTACTTGCAAGCTCATCTCATTCTCAGCTGCGAGACTTCCAAAGCCCGGTTCTGATTCACCAACAAGACCAAAATGGCCTCTCTCACCCTCATCTTTTCCCATTGGAAATCTCCAACGCCAGAAACCACCCATCGGACCTACTCTTCAAGCCCCTCCAGCAAAATTGCACCCTGAAGACCAAGGAACAAACTATTATTCCAAAAGTGATCAAAACGGAGGACGCTACATTCTATCATCAATTACTAGATGACCATAATAACATGCGCTGTGTGAACAAGTTGAATCAAAATCCAAGTAATTTCCTCAACACTTTCCCTCTTGAGGTGGACGCTGGCTTGATGGCATTCTCAGGAGCTGCAAATGCTCAAGCTAGGGAAATATCCACAGCTTCAACACCCTTTAATAGGGTAGCCTTGCAGCAGATGCTTGATTCTTGGCCTCTGACCTAG
Predicted protein sequences of Glyma04g01651
>Glyma04g01651.1   sequence type=predicted peptide   gene model=Glyma04g01651   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLAMEELLCELSDHEKRNEQGLPPGFRFHPTDEELITFYLASKVFNDTFSNLKFAEVDLNRCEPWELPDVAKMGEREWYLFSLRDRKYPTGLRTNRATGAGYWKATGKDKEVYSASSGTLLGMKKTLVFYKGRAPRGEKTKWVMHEYRLDAHFSLPHTYPSKEEWVICRIFHKSGEKRTPVLQVQGHSDASSSPIKSSLSPLLASSSHSQLRDFQSPVLIHQQDQNGLSHPHLFPLEISNARNHPSDLLFKPLQQNCTLKTKEQTIIPKVIKTEDATFYHQLLDDHNNMRCVNKLNQNPSNFLNTFPLEVDAGLMAFSGAANAQAREISTASTPFNRVALQQMLDSWPLT*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo