Glyma04g01550 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g01550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g01550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g01550

Feature Type:	gene_model
Chromosome:	Gm04
Start:	1026220
stop:	1028884
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g01550

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G18830	AT	Annotation by Michelle Graham. TAIR10: polyol/monosaccharide transporter 5 \| chr3:6489000-6491209 REVERSE LENGTH=539	SoyBase	E_val: 0	ISS
GO:0006810	GO-bp	Annotation by Michelle Graham. GO Biological Process: transport	SoyBase	N/A	ISS
GO:0031348	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response	SoyBase	N/A	ISS
GO:0043090	GO-bp	Annotation by Michelle Graham. GO Biological Process: amino acid import	SoyBase	N/A	ISS
GO:0055085	GO-bp	Annotation by Michelle Graham. GO Biological Process: transmembrane transport	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0005351	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sugar:hydrogen symporter activity	SoyBase	N/A	ISS
GO:0005354	GO-mf	Annotation by Michelle Graham. GO Molecular Function: galactose transmembrane transporter activity	SoyBase	N/A	ISS
GO:0005355	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hexose phosphate transport	SoyBase	N/A	ISS
GO:0005365	GO-mf	Annotation by Michelle Graham. GO Molecular Function: myo-inositol transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015144	GO-mf	Annotation by Michelle Graham. GO Molecular Function: carbohydrate transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015145	GO-mf	Annotation by Michelle Graham. GO Molecular Function: monosaccharide transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015148	GO-mf	Annotation by Michelle Graham. GO Molecular Function: D-xylose transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015168	GO-mf	Annotation by Michelle Graham. GO Molecular Function: glycerol transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015575	GO-mf	Annotation by Michelle Graham. GO Molecular Function: mannitol transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015576	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sorbitol transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015591	GO-mf	Annotation by Michelle Graham. GO Molecular Function: D-ribose transmembrane transporter activity	SoyBase	N/A	ISS
GO:0022857	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transmembrane transporter activity	SoyBase	N/A	ISS
KOG0254	KOG	Predicted transporter (major facilitator superfamily)	JGI		ISS
PTHR24063	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24063:SF85	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00083	PFAM	Sugar (and other) transporter	JGI		ISS
UniRef100_G7J6H8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Mannitol transporter n=1 Tax=Medicago truncatula RepID=G7J6H8_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1JSQ4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JSQ4_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma04g01550

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g01550 not represented in the dataset	Glyma04g01550 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g01550 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g014000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g01550

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g01550

Limit To All Plant Sequences

>Glyma04g01550.1   sequence type=CDS   gene model=Glyma04g01550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGAGGGAAAAACAGCAACTCAAAAATCTCTTCAGGATTTTGATCCTCAAAAGACACCCAGAAGGAACAAGTATGCTTTCGCCTGTGCCATTTTGGCTTCCATGACTTCCATATTACTTGGCTATGATGTTGGGGTGATGAGTGGAGCGATTATATACATAAAGAGAGACTTGAAATTGACGGACGTGCAAATCGAGATCCTGGTAGGCATCATCAACCTTTACTCTCTGATAGGTTCATGCCTCGCCGGCAGAACCTCCGACTGGATCGGCCGGCGTTACACGATCGTCCTTGCCGGAAGCATCTTCTTCGCCGGAGCCATCCTGATGGGAATATCCCCGAACTATCCCTTTCTTATGTTCGCGCGCTTCATCGCCGGCGTCGGCATCGGTTATGCCCTCATGATCGCCCCCGTCTACACCACCGAAGTCTCCCCTCCTTCCTGTCGTGGCTTCCTCACCTCCTTCCCAGAGGTATTCATAAATGGAGGGATATTGCTAGGATACATATCAAACTACGGATTTTCAAAGCTGTCACTTGAGCTGGGATGGAGGATGATGCTGGGAGTTGGGGCGGTTCCTTCAGTGATCCTAGCGCTGGGAGTGTTAGCCATGCCAGAGTCGCCACGCTGGCTGGTGATGCGAGGTAGGCTCGGCGAAGCCACCAAAGTCCTCAACAAAACCTCCGACTCCAAAGAAGAGGCTCAGCAGAGGCTAGCCGACATCAAAGCTGCTGCTGGCATCCCCGAGAGTTGCACCGACGACGTCGTTCAAGTAACCAACCGAAACCACGGCGGCGGTGTATGGAAAGAGTTCTTCCTTTACCCTACACCGGCGGTGCGCCACATCCTCATAGCCGCTCTCGGGATTCATTTCTTTCAGCAGGCTTCCGGAATAGACGCCGTGGTTTTGTACAGCCCCGAGATTTTCAAGAAGGCTGGGCTGGAATCCGATGGGGAACAGCTTCTGGCAACCGTGGCCGTTGGATTCGCCAAAACCGTATTCATCTTAGTGGCTACGTTTTTGTTGGATCGGGTGGGGCGTCGGCCGCTGTTGTTGACAAGTGTTGGCGGAATGGTGTTTTCTCTTCTGACGCTGGGGTTGAGTCTCACCGTCATTGACCACTCACGCGCCGTCCTCAAGTGGGCCATTGGGTTGAGCATAGGCATGGTTTTGTCCTACGTGTCCACTTTCTCCGTCGGAGCGGGTCCCATCACGTGGGTTTATAGCTCCGAGATCTTCCCCTTAAGGCTTCGCGCGCAGGGTGCGGCTATGGGAGTTGTCGTGAATAGGGTCACTAGTGGGGTCATCTCAATGACTTTCCTGTCCCTCTCTAATAAGATCACTATTGGTGGGGCATTCTTCCTCTTTGGGGGAATCGCAATGTGTGGATGGATCTTCTTCTATACCATGCTCCCCGAAACACAGGGCAAGACCCTTGAGGAAATGGAAGGCTCCTTTGGTAAATTCGCCTCATGGTCCAAGGGTAAGGACGGTGATAACGGAGACATCCAATTAGCCAATTAG

Predicted protein sequences of Glyma04g01550

Limit To All Plant Sequences

>Glyma04g01550.1   sequence type=predicted peptide   gene model=Glyma04g01550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEGKTATQKSLQDFDPQKTPRRNKYAFACAILASMTSILLGYDVGVMSGAIIYIKRDLKLTDVQIEILVGIINLYSLIGSCLAGRTSDWIGRRYTIVLAGSIFFAGAILMGISPNYPFLMFARFIAGVGIGYALMIAPVYTTEVSPPSCRGFLTSFPEVFINGGILLGYISNYGFSKLSLELGWRMMLGVGAVPSVILALGVLAMPESPRWLVMRGRLGEATKVLNKTSDSKEEAQQRLADIKAAAGIPESCTDDVVQVTNRNHGGGVWKEFFLYPTPAVRHILIAALGIHFFQQASGIDAVVLYSPEIFKKAGLESDGEQLLATVAVGFAKTVFILVATFLLDRVGRRPLLLTSVGGMVFSLLTLGLSLTVIDHSRAVLKWAIGLSIGMVLSYVSTFSVGAGPITWVYSSEIFPLRLRAQGAAMGVVVNRVTSGVISMTFLSLSNKITIGGAFFLFGGIAMCGWIFFYTMLPETQGKTLEEMEGSFGKFASWSKGKDGDNGDIQLAN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain