SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g01181

Feature Type:gene_model
Chromosome:Gm04
Start:739291
stop:739947
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g01181
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G21490AT Annotation by Michelle Graham. TAIR10: dehydrin LEA | chr2:9206209-9207040 REVERSE LENGTH=185 SoyBaseE_val: 1.00E-19ISS
GO:0009415GO-bp Annotation by Michelle Graham. GO Biological Process: response to water stimulus SoyBaseN/AISS
GO:0016114GO-bp Annotation by Michelle Graham. GO Biological Process: terpenoid biosynthetic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF00257PFAM Dehydrin JGI ISS
UniRef100_O23957UniRef Annotation by Michelle Graham. Most informative UniRef hit: Dehydrin n=2 Tax=Glycine max RepID=O23957_SOYBN SoyBaseE_val: 2.00E-115ISS
UniRef100_O23957UniRef Annotation by Michelle Graham. Best UniRef hit: Dehydrin n=2 Tax=Glycine max RepID=O23957_SOYBN SoyBaseE_val: 2.00E-115ISS

Expression Patterns of Glyma04g01181
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g01181 not represented in the dataset
Glyma04g01181 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g01181 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g009900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g01181
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g01181
>Glyma04g01181.1   sequence type=CDS   gene model=Glyma04g01181   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGAAGCACAACTACGAGACCAGCATGGCAACCCTGTCCCACTCACCGATCAATACGGTAATCCGGTTATCTTAACTGACGAGCGCGGTAATCCCGTCCAACTCACTGGTGTCGCTACCACCGCTACCGGCACAGCAGGTTCTGGGTTTGGGTCCTATGGTACCGGTGCTTACGGTGGTGGTGCAAGTGCAACCACCGTTGCAGATCTTTTGGCAACCCAACCAAGGAGTGGCAGGGAGGCTAGAGAGCTTCGTCGTTCCTCCAGTTCAAGCTCTAGCTCGTCTGAGGATGATGGGCAAGGTGGGAGGAGGAAGAAGGGAGTGAAGGATAAAATAAAAGAGAAACTACCAGGGGTAGGAGGAGGGAATAATAATAAGGAGCATGCACACACAACAACTGCTCCAACCACCGCCACTAACCACCCTGCTGATCAGCATGAGAAGAAGGGCATAATGGAGAGGATCAAAGAAAAATTGCCTGGCCACCACACCCACTGA
Predicted protein sequences of Glyma04g01181
>Glyma04g01181.1   sequence type=predicted peptide   gene model=Glyma04g01181   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEAQLRDQHGNPVPLTDQYGNPVILTDERGNPVQLTGVATTATGTAGSGFGSYGTGAYGGGASATTVADLLATQPRSGREARELRRSSSSSSSSSEDDGQGGRRKKGVKDKIKEKLPGVGGGNNNKEHAHTTTAPTTATNHPADQHEKKGIMERIKEKLPGHHTH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo