SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g01130

Feature Type:gene_model
Chromosome:Gm04
Start:710035
stop:711409
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g01130
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G20440AT Annotation by Michelle Graham. TAIR10: cold-regulated 47 | chr1:7084722-7085664 REVERSE LENGTH=265 SoyBaseE_val: 5.00E-22ISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009415GO-bp Annotation by Michelle Graham. GO Biological Process: response to water stimulus SoyBaseN/AISS
GO:0009631GO-bp Annotation by Michelle Graham. GO Biological Process: cold acclimation SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0010286GO-bp Annotation by Michelle Graham. GO Biological Process: heat acclimation SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF00257PFAM Dehydrin JGI ISS
UniRef100_C6TAX7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TAX7_SOYBN SoyBaseE_val: 4.00E-142ISS
UniRef100_D3YBF7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Dehydrin b n=1 Tax=Trifolium repens RepID=D3YBF7_TRIRP SoyBaseE_val: 6.00E-35ISS

Expression Patterns of Glyma04g01130
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g01130
ParalogEvidenceComments
Glyma06g01171 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g01130 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g009400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g01130
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g01130
>Glyma04g01130.1   sequence type=CDS   gene model=Glyma04g01130   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGACGAGACCCAGAACAAGTATGAGAGCTCTGAGGTTGAGGTCCAGGATCGTGGTGTTTTTGACTTTCTCGGTAAGAAAAAGGATGAAGAAGACAAGCCTCATCCTCAGGAGGAGGTCATCGCCACCGAGTTTCAAAAAGTCACTGTCTCAGACCAAGGAGAGAACAAGCACAGCCTCTTAGAAAAGCTTCACCGATCTGACAGCAGCTCTAGCTCTTCAAGTGAGGAGGAAGGAGAAGATGGAGAGAAAAGGAAGAAGAAGAAGAAGGAAAAGAAAGGGCTGAAAGAGAAGATCGAGGAGAAAATAGAGGGTGATCATCATCATCACAAGGATGAGGACACAAGTGTCCCTGTTGAGAAAGTTGAGGTTGTTGAAACAGCACATGCTGAGGAAAAGAAGGGGTTCCTCGACAAGATTAAGGAGAAGCTACCAGGGCACAAGAAGACAGAGGAGGCCACAGCTACTACTCCTCCTCCACCACCACCTGTTGCATCATTGGAGCATGGTGAAGGTGCTCATCATGAAGGAGAGGCCAAGGAGAAGAAAGGTATATTAGAAAAGATAAAAGAGAAGCTTCCTGGTTATCACTCCAAGACAGAGGAGGAAAAGGAAAAGGAAAAGGAGAGTGGTGCTCATTGA
Predicted protein sequences of Glyma04g01130
>Glyma04g01130.1   sequence type=predicted peptide   gene model=Glyma04g01130   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADETQNKYESSEVEVQDRGVFDFLGKKKDEEDKPHPQEEVIATEFQKVTVSDQGENKHSLLEKLHRSDSSSSSSSEEEGEDGEKRKKKKKEKKGLKEKIEEKIEGDHHHHKDEDTSVPVEKVEVVETAHAEEKKGFLDKIKEKLPGHKKTEEATATTPPPPPPVASLEHGEGAHHEGEAKEKKGILEKIKEKLPGYHSKTEEEKEKEKESGAH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo