SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g00770

Feature Type:gene_model
Chromosome:Gm04
Start:429799
stop:433983
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g00770
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G38800AT Annotation by Michelle Graham. TAIR10: methylthioadenosine nucleosidase 1 | chr4:18113355-18114996 REVERSE LENGTH=267 SoyBaseE_val: 7.00E-127ISS
GO:0000003GO-bp Annotation by Michelle Graham. GO Biological Process: reproduction SoyBaseN/AISS
GO:0001944GO-bp Annotation by Michelle Graham. GO Biological Process: vasculature development SoyBaseN/AISS
GO:0009116GO-bp Annotation by Michelle Graham. GO Biological Process: nucleoside metabolic process SoyBaseN/AISS
GO:0019509GO-bp Annotation by Michelle Graham. GO Biological Process: L-methionine salvage from methylthioadenosine SoyBaseN/AISS
GO:0048573GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0008930GO-mf Annotation by Michelle Graham. GO Molecular Function: methylthioadenosine nucleosidase activity SoyBaseN/AISS
PTHR21234Panther PURINE NUCLEOSIDE PHOSPHORYLASE JGI ISS
PTHR21234:SF5Panther MTA/SAH NUCLEOSIDASE JGI ISS
PF01048PFAM Phosphorylase superfamily JGI ISS
UniRef100_B6DX57UniRef Annotation by Michelle Graham. Most informative UniRef hit: 5'-methylthioadenosine nucleosidase n=1 Tax=Lupinus luteus RepID=B6DX57_LUPLU SoyBaseE_val: 1.00E-159ISS
UniRef100_I1JSG1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JSG1_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g00770
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g00770
ParalogEvidenceComments
Glyma06g00790 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g00770 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g005900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g00770
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g00770
>Glyma04g00770.1   sequence type=CDS   gene model=Glyma04g00770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGCGCTTGGGGACCAATCAGAGGAACAAGCCATGGCTGCCCAACCTAAACCTCAGAACCGACCCATTTCTAACATCGTCATCGTCGTTGCTATGCAGACGGAGGCACTTCCCATTGTTAACAGATTCCAGCTCACTGAGGACCCTGACACCCCGTTTCCGCAAGGGGTTCCTTGGGTCCGTTATCAGGGGACATACAAAGATCTTAATATAAGCTTGATTTGGCCGGGAAAAGATCCAACTTTGGGGGTTGATAGTGTAGGCACGATATCATCTGCTCTTGTAACGTATGCTGCTATTCAAGCATTACAACCAGACTTGATCATCAATGCAGGCACTGCTGGTGGCTTCAAGGCCAAAGGAGCTAGTATTGGTGATGTTTTCATTGTATCAGATTGTGCTTTTCACGACAGAAGAATACCCATACCTGTTTTTGATCTGTATGGAGTTGGTTTACGTAAAGCCTTTGTAGCACCCAACCTTGTAAAGGAGCTTAATCTAAAGGTGGGTAAATTGTCTACTGGTGACTCTTTAGATATGACACAGCAGGATGAATCGTCAATCATTGCAAATGATGCCACAGTTAAAGATATGGAGGGAGCAGCTATTGCTTATGTTTCTGACCTTCTGAAAGTTCCTGCAATATTTGTAAAAGCTGTGACTGATATCATTGATGGTGACAAACCAACTGCAGAAGAATTCCTGCAAAATTTGGCAGCTGTAACTACTGCACTTGATCTGGCAGTTGAACAAGTTATTAATTTTATTAATGGAAAGTGCGAATCTGAACTTTGA
Predicted protein sequences of Glyma04g00770
>Glyma04g00770.1   sequence type=predicted peptide   gene model=Glyma04g00770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAALGDQSEEQAMAAQPKPQNRPISNIVIVVAMQTEALPIVNRFQLTEDPDTPFPQGVPWVRYQGTYKDLNISLIWPGKDPTLGVDSVGTISSALVTYAAIQALQPDLIINAGTAGGFKAKGASIGDVFIVSDCAFHDRRIPIPVFDLYGVGLRKAFVAPNLVKELNLKVGKLSTGDSLDMTQQDESSIIANDATVKDMEGAAIAYVSDLLKVPAIFVKAVTDIIDGDKPTAEEFLQNLAAVTTALDLAVEQVINFINGKCESEL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo