Glyma04g00480 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g00480

Feature Type:	gene_model
Chromosome:	Gm04
Start:	250427
stop:	252572
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g00480

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G16800	AT	Annotation by Michelle Graham. TAIR10: high-affinity nickel-transport family protein \| chr2:7285824-7287188 FORWARD LENGTH=372	SoyBase	E_val: 8.00E-148	ISS
GO:0000394	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA splicing, via endonucleolytic cleavage and ligation	SoyBase	N/A	ISS
GO:0009086	GO-bp	Annotation by Michelle Graham. GO Biological Process: methionine biosynthetic process	SoyBase	N/A	ISS
GO:0009220	GO-bp	Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0009616	GO-bp	Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing	SoyBase	N/A	ISS
GO:0010050	GO-bp	Annotation by Michelle Graham. GO Biological Process: vegetative phase change	SoyBase	N/A	ISS
GO:0015675	GO-bp	Annotation by Michelle Graham. GO Biological Process: nickel cation transport	SoyBase	N/A	ISS
GO:0030001	GO-bp	Annotation by Michelle Graham. GO Biological Process: metal ion transport	SoyBase	N/A	ISS
GO:0055085	GO-bp	Annotation by Michelle Graham. GO Biological Process: transmembrane transport	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0015099	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nickel cation transmembrane transporter activity	SoyBase	N/A	ISS
GO:0046872	GO-mf	Annotation by Michelle Graham. GO Molecular Function: metal ion binding	SoyBase	N/A	ISS
PF03824	PFAM	High-affinity nickel-transport protein	JGI		ISS
UniRef100_C6TEJ4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TEJ4_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_G7JMC5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: High-affinity nickel-transport family protein, putative n=1 Tax=Medicago truncatula RepID=G7JMC5_MEDTR	SoyBase	E_val: 5.00E-172	ISS

Expression Patterns of Glyma04g00480

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g00480

Paralog	Evidence	Comments
Glyma06g00580	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g00480 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g003500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g00480

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g00480

Limit To All Plant Sequences

>Glyma04g00480.1   sequence type=CDS   gene model=Glyma04g00480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATAGGCTTCTATCATCGTCTTCACCCCCTTCTTTTACATTTCTCACTCGATTCGAATCTGCAACTGCAAGATTCAATTTCTCTCCGTCAACACGTTCTCACTCTCACTTGAAGCGGCTCTCCTCAATTTGTTGCCAGCATGCAAATCCATCTCCTTTTTCCTCTTCCACTCCCTTTCTCGCTTCTTCCAACCACCCCATTAATTTTCCATCCTTTTCCTCTTCTTCAGATCCCTCCACACTCGAATCCCATTCTCTCAATCAAATCAAAACCGGGGCTTTCCCAAAACCAAAGGTAATAACAGCTCGGACGCTTGTAATACTTTCTGCTCTTGCTATGATCTTAATCCAACCAACTATTGCACCAGCAGCTTTTGCAACCTTTCAAACTGCTGCCAAGACTGGTGGTCCTGCTGCTGCAGCTGCAGTTGGTAGAAAACTAATCCACACGGAGCTACTAAGTAGTGCTTGGACTGGTTTCTTGGCTGGCTGCTTACACACCTTATCAGGGCCTGACCACCTAGCTGCCTTGGCTCCATTGTCAATCGGTCGAACCCGAATGGAGAGTGCTGCTGTTGGAGCCCTTTGGGGTTGTGGCCATGATGCTGGTCAAGTTCTTTTTGGGTTAATATTTCTAATCCTCAAGGATCAACTCCATATTGAAATTATCCGAACTTGGGGTACCAGAGTGGTGGGTCTTACTCTGCTAATAATTGGTGCTATGGGAATTAGAGAAGCATCAGAAGTACATGCCCCAATTGTTGCTTTAGAAAGTGGTGAATGTGATGTCAACGTGTATGAATCGCTTGATAATCCAACAGTGGGCAAAAAGAAGATAGGTTTTGCTACTTTTGCAACAGGGATAGTTCATGGCCTGCAACCAGATGCATTGATGATGGTTTTGCCTGCCCTTGCTTTGCCTTCGCGTTTGGCTGGTGCTGCGTTTCTCATCATGTTCTTAATTGGAACTGTAATTGCAATGGGAAGTTATACCGTGTTTATAGGTTCGTGTAGCCAGGCACTGAAGGATAGAGTACCTAGGATAACTGAGAAACTCACTTGGGTTTCCTCCCTTATTGCAATAGCCCTCGGATTTGCTATCATTATTAGCCAGTTTTTTGGGTTTAGTCTGTATTAA

Predicted protein sequences of Glyma04g00480

Limit To All Plant Sequences

>Glyma04g00480.1   sequence type=predicted peptide   gene model=Glyma04g00480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDRLLSSSSPPSFTFLTRFESATARFNFSPSTRSHSHLKRLSSICCQHANPSPFSSSTPFLASSNHPINFPSFSSSSDPSTLESHSLNQIKTGAFPKPKVITARTLVILSALAMILIQPTIAPAAFATFQTAAKTGGPAAAAAVGRKLIHTELLSSAWTGFLAGCLHTLSGPDHLAALAPLSIGRTRMESAAVGALWGCGHDAGQVLFGLIFLILKDQLHIEIIRTWGTRVVGLTLLIIGAMGIREASEVHAPIVALESGECDVNVYESLDNPTVGKKKIGFATFATGIVHGLQPDALMMVLPALALPSRLAGAAFLIMFLIGTVIAMGSYTVFIGSCSQALKDRVPRITEKLTWVSSLIAIALGFAIIISQFFGFSLY*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain