SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma04g00300

Feature Type:gene_model
Chromosome:Gm04
Start:101780
stop:104074
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G16210AT Annotation by Michelle Graham. TAIR10: unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1014 (InterPro:IPR010422); Has 16107 Blast hits to 8386 proteins in 1107 species: Archae - 26; Bacteria - 3370; Metazoa - 4013; Fungi - 1516; Plants - 526; Viruses - 120; Other Eukaryotes - 6536 (source: NCBI BLink). | chr1:5546352-5547447 REVERSE LENGTH=234 SoyBaseE_val: 7.00E-108ISS
GO:0006623GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to vacuole SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0008284GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of cell proliferation SoyBaseN/AISS
GO:0009610GO-bp Annotation by Michelle Graham. GO Biological Process: response to symbiotic fungus SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0016197GO-bp Annotation by Michelle Graham. GO Biological Process: endosomal transport SoyBaseN/AISS
GO:0043161GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0043248GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome assembly SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG3223 KOG Uncharacterized conserved protein JGI ISS
PTHR21680Panther UNCHARACTERIZED JGI ISS
PF06244PFAM Protein of unknown function (DUF1014) JGI ISS
UniRef100_G7J994UniRef Annotation by Michelle Graham. Most informative UniRef hit: Coiled-coil domain-containing protein n=1 Tax=Medicago truncatula RepID=G7J994_MEDTR SoyBaseE_val: 7.00E-107ISS
UniRef100_I1JSB8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JSB8_SOYBN SoyBaseE_val: 7.00E-157ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma06g00340 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g001700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma04g00300.1   sequence type=CDS   gene model=Glyma04g00300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCGAAGAAGATGGGGGTGAACACGAAGGCGGAGGCGGCGAGGGCTCGTAAGAGCGCGGCGGATACGGAGCGGAAGGAGAAGGAGAGTCGAGAGAAGGAGGACCAGTACTGGCGAGAGGCGGAGGGTTCAAAGTCACGCGCCGCGAAGAAGAAGGAGGAAGAGGCCGAAAAGAGGGCGGAGGCAGCCGCGCGGAAAGCGGAGGCGCGACGGTTGGCGGAGCAGGAGGAGAAGGAGCTGGAGAAGTCGATGAAGAAGGTGGACAAGAAGGCGACACGGGTGTCGATCCCGGTGCCGAAGGTGACGGAGGTGGAGCTGAGGAGGCGGAGGGAGGAGGAGCAGGCGGAGGCTGAGAGGAAGGCGGAGGAGGCTAAGAAGCAGCAGAGTCGGACGGCGGCAGAGGAAGAGTACGAGAGAATGGTGCTTATTTCGAACACTAATCGCGACGATTCGATCATCGAAGCAAGAACATTGGATGATGCCATCGCTCAGATGACCGTCGTGGATAACTTGCCCCCAGATCGCCATCCAGAGAGGCGCCTCAAGGCCTCATTCAAGGCGTTTGAAGAAGCTGAGCTGCCCAAGTTGAAGGAAGAGAAACCGGGTCTTACTCACACTCAGTACAAGGACATGATATGGAAGTTATGGAAGAAATCTCCTGACAATCCTCTTAATCAAATTGCTGAGTGA

>Glyma04g00300.1   sequence type=predicted peptide   gene model=Glyma04g00300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPKKMGVNTKAEAARARKSAADTERKEKESREKEDQYWREAEGSKSRAAKKKEEEAEKRAEAAARKAEARRLAEQEEKELEKSMKKVDKKATRVSIPVPKVTEVELRRRREEEQAEAERKAEEAKKQQSRTAAEEEYERMVLISNTNRDDSIIEARTLDDAIAQMTVVDNLPPDRHPERRLKASFKAFEEAELPKLKEEKPGLTHTQYKDMIWKLWKKSPDNPLNQIAE*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo