SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g40640): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g40640): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g40640

Feature Type:gene_model
Chromosome:Gm03
Start:46334890
stop:46336206
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G04790AT Annotation by Michelle Graham. TAIR10: Ribose 5-phosphate isomerase, type A protein | chr3:1313365-1314195 FORWARD LENGTH=276 SoyBaseE_val: 9.00E-134ISS
GO:0000096GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur amino acid metabolic process SoyBaseN/AISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006546GO-bp Annotation by Michelle Graham. GO Biological Process: glycine catabolic process SoyBaseN/AISS
GO:0006569GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0006733GO-bp Annotation by Michelle Graham. GO Biological Process: oxidoreduction coenzyme metabolic process SoyBaseN/AISS
GO:0006766GO-bp Annotation by Michelle Graham. GO Biological Process: vitamin metabolic process SoyBaseN/AISS
GO:0008652GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process SoyBaseN/AISS
GO:0009052GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt, non-oxidative branch SoyBaseN/AISS
GO:0009072GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family metabolic process SoyBaseN/AISS
GO:0009106GO-bp Annotation by Michelle Graham. GO Biological Process: lipoate metabolic process SoyBaseN/AISS
GO:0009108GO-bp Annotation by Michelle Graham. GO Biological Process: coenzyme biosynthetic process SoyBaseN/AISS
GO:0009117GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide metabolic process SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009684GO-bp Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0019253GO-bp Annotation by Michelle Graham. GO Biological Process: reductive pentose-phosphate cycle SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0019748GO-bp Annotation by Michelle Graham. GO Biological Process: secondary metabolic process SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0044272GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur compound biosynthetic process SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0004751GO-mf Annotation by Michelle Graham. GO Molecular Function: ribose-5-phosphate isomerase activity SoyBaseN/AISS
KOG3075 KOG Ribose 5-phosphate isomerase JGI ISS
PTHR11934Panther RIBOSE-5-PHOSPHATE ISOMERASE JGI ISS
PF06026PFAM Ribose 5-phosphate isomerase A (phosphoriboisomerase A) JGI ISS
UniRef100_G7L1U4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Chloroplast ribose-5-phosphate isomerase n=1 Tax=Medicago truncatula RepID=G7L1U4_MEDTR SoyBaseE_val: 9.00E-164ISS
UniRef100_UPI0001CA9BD4UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0001CA9BD4 related cluster n=1 Tax=unknown RepID=UPI0001CA9BD4 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g40640 not represented in the dataset

Glyma03g40640 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma19g43310 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g246300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g40640.1   sequence type=CDS   gene model=Glyma03g40640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCCTTATCCCTCTCCTCTCCCCCATCTCTCTCTTCCGCACACCACAACGCCTCCACGCGCCTTATTCTACGCACCCCTAACTCCCTTAAACTGCGCACTCCACCCCACTCCCTCCCCGCCATCCGCGCCATCACCCTCACCCAGGACGACCTCAAGAGACTCGCCGCCGACAAGGCCGTGGAGTCCGTCAAGAGCGGCATGGTCCTCGGCCTGGGCACCGGCTCCACTGCTGCCTTCGTCGTCGCCAAGCTTGGCGCCCTTCTCGCCTCCGGCCAACTCTCCGACATCGTCGGTGTCCCCACCTCCAAACGCACGGAGGAGCAGGCCCGCTCCCTCGGCATCCCCCTCTCCGTCCTCGACGACAACCCCCGCCTCGATCTCGCCATCGACGGCGCCGACGAGGTCGACCCCGACCTCAACCTCGTCAAAGGCCGCGGCGGCGCCCTCCTCCGCGAGAAGATGGTCGAGGCCGCCTCCGACAAGTTCGTCGTGGTCGTCGACGACACCAAGCTCGTGGACGGCCTCGGCGGAAGCGGGCTGGCCATGCCGGTGGAGGTGGTCCAGTTCTGCTGGAAGTACAATCTGGATCGGCTTCAGGAGCTTTTCAAGGAAGAAGGTGTGGAAGCAAAATTGAGATTGGAGGAGAGTGGGAAACCCTACGTCACCGATAATTCCAATTACATCGTGGATTTGTACTTCAAGACTCCAATTAGGGATGCATTGGCCGCAGGCGCTGAAATTTCCGCTCTGGAAGGCGTCGTCGAGCATGGCTTGTTCCTCAACATGGCCACTTCTGTCATCATCGCTGGCAAATCTGGCGTTGAAGTCAAGGCCAAGTGA

>Glyma03g40640.1   sequence type=predicted peptide   gene model=Glyma03g40640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASLSLSSPPSLSSAHHNASTRLILRTPNSLKLRTPPHSLPAIRAITLTQDDLKRLAADKAVESVKSGMVLGLGTGSTAAFVVAKLGALLASGQLSDIVGVPTSKRTEEQARSLGIPLSVLDDNPRLDLAIDGADEVDPDLNLVKGRGGALLREKMVEAASDKFVVVVDDTKLVDGLGGSGLAMPVEVVQFCWKYNLDRLQELFKEEGVEAKLRLEESGKPYVTDNSNYIVDLYFKTPIRDALAAGAEISALEGVVEHGLFLNMATSVIIAGKSGVEVKAK*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo