SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g38960

Feature Type:gene_model
Chromosome:Gm03
Start:45206859
stop:45208844
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g38960
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G15510AT Annotation by Michelle Graham. TAIR10: Photosystem II reaction center PsbP family protein | chr4:8860701-8862529 FORWARD LENGTH=287 SoyBaseE_val: 4.00E-107ISS
GO:0048564GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem I assembly SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009543GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid lumen SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009654GO-cc Annotation by Michelle Graham. GO Cellular Compartment: oxygen evolving complex SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0030095GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast photosystem II SoyBaseN/AISS
GO:0031977GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid lumen SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PF01789PFAM PsbP JGI ISS
UniRef100_B9RFL8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Thylakoid lumenal 21.5 kDa protein, chloroplast, putative n=1 Tax=Ricinus communis RepID=B9RFL8_RICCO SoyBaseE_val: 3.00E-123ISS
UniRef100_I1JR41UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JR41_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma03g38960
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma03g38960 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g230300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g38960
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g38960
>Glyma03g38960.1   sequence type=CDS   gene model=Glyma03g38960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTAATGCAATTATAATGCCGGGTTTTCTGCTTCGACCCACTACCCAGACGACGCCGTTTCGGTTGCCCAATCACACTCACTCCTTCCATTCCCCTCGCTGCTCCCTTTCCCTCACACCCCAATCGGCTAAAGCTTTTGCAGTTCCAAGGAGGAAAGCATTGTCCTTGATCTTATCGAGTTACTTTCTCTCGGAGGCTGGTTTAGCATTGGCTCAACAGTCTCCTGTGTTCCGCGAATACATAGACGCATTTGATGGTTATTCATTCCAGTACCCGGGGAGTTGGATTCAAGTCCGAGGTGCCGGGGCCGACATATTCTTCAGGGACCCTTTTGTTCTTGATGAAAATCTATCTCTTGAAATTTCTTCACCTTCATCTTCCCAGTACAAGAGTGTTGAAGACTTGGGTCCACCCCAAGAAGCTGGAAAGAAAGTGCTCAAACAGTATCTGACTGAGTTTATGTCTACTAGACTCGGCGTTAGACGTGAATCAAATATTCTTTCCACGTCTTCAAGAGTAGCTGATGATGGCAGGTTATACTATCAAGTTGAGGTAAACATAAAGTCATATGCCAATAACAACGAGCTTGCTGTTATGCCAGAAGCCCGAGTGGTACGTCTGGAATGGGATCGGAGGTACCTATCTGTTCTTGGGGTTGAAAACAACCAATTGTATGAGTTGAGATTGCAGGTGCCAGAAAATGTGTTTTCAGAGGAGGAAAATGATCTTCGTCGAATCATGGATTCGTTTCGAGTGAACAAGATTGCCGCTTAG
Predicted protein sequences of Glyma03g38960
>Glyma03g38960.1   sequence type=predicted peptide   gene model=Glyma03g38960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANAIIMPGFLLRPTTQTTPFRLPNHTHSFHSPRCSLSLTPQSAKAFAVPRRKALSLILSSYFLSEAGLALAQQSPVFREYIDAFDGYSFQYPGSWIQVRGAGADIFFRDPFVLDENLSLEISSPSSSQYKSVEDLGPPQEAGKKVLKQYLTEFMSTRLGVRRESNILSTSSRVADDGRLYYQVEVNIKSYANNNELAVMPEARVVRLEWDRRYLSVLGVENNQLYELRLQVPENVFSEEENDLRRIMDSFRVNKIAA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo