Glyma03g38960 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g38960): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g38960): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g38960

Feature Type:	gene_model
Chromosome:	Gm03
Start:	45206859
stop:	45208844
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma03g38960

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G15510	AT	Annotation by Michelle Graham. TAIR10: Photosystem II reaction center PsbP family protein \| chr4:8860701-8862529 FORWARD LENGTH=287	SoyBase	E_val: 4.00E-107	ISS
GO:0048564	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosystem I assembly	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009535	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane	SoyBase	N/A	ISS
GO:0009543	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid lumen	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0009579	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: thylakoid	SoyBase	N/A	ISS
GO:0009654	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: oxygen evolving complex	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0030095	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast photosystem II	SoyBase	N/A	ISS
GO:0031977	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: thylakoid lumen	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
PF01789	PFAM	PsbP	JGI		ISS
UniRef100_B9RFL8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Thylakoid lumenal 21.5 kDa protein, chloroplast, putative n=1 Tax=Ricinus communis RepID=B9RFL8_RICCO	SoyBase	E_val: 3.00E-123	ISS
UniRef100_I1JR41	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JR41_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma03g38960

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g38960 not represented in the dataset	Glyma03g38960 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma03g38960 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.03g230300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma03g38960

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma03g38960

Limit To All Plant Sequences

>Glyma03g38960.1   sequence type=CDS   gene model=Glyma03g38960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTAATGCAATTATAATGCCGGGTTTTCTGCTTCGACCCACTACCCAGACGACGCCGTTTCGGTTGCCCAATCACACTCACTCCTTCCATTCCCCTCGCTGCTCCCTTTCCCTCACACCCCAATCGGCTAAAGCTTTTGCAGTTCCAAGGAGGAAAGCATTGTCCTTGATCTTATCGAGTTACTTTCTCTCGGAGGCTGGTTTAGCATTGGCTCAACAGTCTCCTGTGTTCCGCGAATACATAGACGCATTTGATGGTTATTCATTCCAGTACCCGGGGAGTTGGATTCAAGTCCGAGGTGCCGGGGCCGACATATTCTTCAGGGACCCTTTTGTTCTTGATGAAAATCTATCTCTTGAAATTTCTTCACCTTCATCTTCCCAGTACAAGAGTGTTGAAGACTTGGGTCCACCCCAAGAAGCTGGAAAGAAAGTGCTCAAACAGTATCTGACTGAGTTTATGTCTACTAGACTCGGCGTTAGACGTGAATCAAATATTCTTTCCACGTCTTCAAGAGTAGCTGATGATGGCAGGTTATACTATCAAGTTGAGGTAAACATAAAGTCATATGCCAATAACAACGAGCTTGCTGTTATGCCAGAAGCCCGAGTGGTACGTCTGGAATGGGATCGGAGGTACCTATCTGTTCTTGGGGTTGAAAACAACCAATTGTATGAGTTGAGATTGCAGGTGCCAGAAAATGTGTTTTCAGAGGAGGAAAATGATCTTCGTCGAATCATGGATTCGTTTCGAGTGAACAAGATTGCCGCTTAG

Predicted protein sequences of Glyma03g38960

Limit To All Plant Sequences

>Glyma03g38960.1   sequence type=predicted peptide   gene model=Glyma03g38960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANAIIMPGFLLRPTTQTTPFRLPNHTHSFHSPRCSLSLTPQSAKAFAVPRRKALSLILSSYFLSEAGLALAQQSPVFREYIDAFDGYSFQYPGSWIQVRGAGADIFFRDPFVLDENLSLEISSPSSSQYKSVEDLGPPQEAGKKVLKQYLTEFMSTRLGVRRESNILSTSSRVADDGRLYYQVEVNIKSYANNNELAVMPEARVVRLEWDRRYLSVLGVENNQLYELRLQVPENVFSEEENDLRRIMDSFRVNKIAA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain