SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g38930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g38930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g38930

Feature Type:gene_model
Chromosome:Gm03
Start:45195272
stop:45199164
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g38930
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G09340AT Annotation by Michelle Graham. TAIR10: chloroplast RNA binding | chr1:3015473-3018035 FORWARD LENGTH=378 SoyBaseE_val: 0ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0005996GO-bp Annotation by Michelle Graham. GO Biological Process: monosaccharide metabolic process SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0007623GO-bp Annotation by Michelle Graham. GO Biological Process: circadian rhythm SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0009658GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast organization SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010218GO-bp Annotation by Michelle Graham. GO Biological Process: response to far red light SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0018119GO-bp Annotation by Michelle Graham. GO Biological Process: peptidyl-cysteine S-nitrosylation SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0032544GO-bp Annotation by Michelle Graham. GO Biological Process: plastid translation SoyBaseN/AISS
GO:0034660GO-bp Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042631GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to water deprivation SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0042793GO-bp Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter SoyBaseN/AISS
GO:0043085GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of catalytic activity SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0045727GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of translation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005777GO-cc Annotation by Michelle Graham. GO Cellular Compartment: peroxisome SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0010287GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastoglobule SoyBaseN/AISS
GO:0010319GO-cc Annotation by Michelle Graham. GO Cellular Compartment: stromule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG1429 KOG dTDP-glucose 4-6-dehydratase/UDP-glucuronic acid decarboxylase JGI ISS
PTHR10366Panther NAD DEPENDENT EPIMERASE/DEHYDRATASE JGI ISS
PTHR10366:SF67Panther DTDP-GLUCOSE 4-6-DEHYDRATASE-RELATED JGI ISS
PF01370PFAM NAD dependent epimerase/dehydratase family JGI ISS
UniRef100_B9RFM2UniRef Annotation by Michelle Graham. Most informative UniRef hit: NAD dependent epimerase/dehydratase, putative n=1 Tax=Ricinus communis RepID=B9RFM2_RICCO SoyBaseE_val: 0ISS
UniRef100_I1JR38UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JR38_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma03g38930
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g38930 not represented in the dataset
Glyma03g38930 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma03g38930 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g230000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g38930
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g38930
>Glyma03g38930.1   sequence type=CDS   gene model=Glyma03g38930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAAGAGTGGTGGCACTCCAACAGAACCAACTATCTTTCTCTACCTTAGCTTCCTCTCTTTCTGACTTCAGTGGAACCAGACTTCAAACTCAACTTCAGTTCAAGAGAAAGCAATGCCATCCAAAAGGGTCTTTCTACGTCTCCGCATCGAGCACCAAGAAAATCCTAATAATGGGAGGCACCAGGTTTATTGGTGTGTTTTTGTCTAGGCTCCTTGTCAAAGAGGGTCACCAGGTGACTTTATTCACAAGAGGTAAAGCGCCTGTCACTCAACAGTTGCCAGGTGAATCAGACAGTGATTATGCTGATTTTTCTTCCAAGATCTTGCATTTGAAAGGAGACAGGAAGGACTTCGACTTTGTAAAATCCAGTCTCTCAGCAGAGGGATTTGATGTTGTTTATGACATAAATGGACGCGAGGCAGATGAAGTTGAACCCATACTGGATGCTCTGCCTAATCTGGAGCAGTTTATTTACTGCTCTTCTGCCGGTGTCTATCTCAAATCTGATCTATTACCTCACGCAGAGACTGATGCAGTTGATCCTAAGAGCAGACACAAGGGAAAGCTTGAGACAGAGAGTTTGCTACAAGCAAGGGGTGTTAATTGGACATCTATAAGGCCAGTCTACATCTATGGACCCTTGAACTACAACCCTGTTGAAGAGTGGTTCTTCCATAGATTGAAAGCGGGACGCCCAATTCCTATCCCCGGCTCAGGAATACAGATAACCCAACTTGGTCATGTTAAGGATTTGGCAAAAGCTTTTATCCAGGTTCTTGGTAATGAGAAGGCCAGCAAGGAAGTATTCAACATCTCGGGAGATAAGTATGTCACATTTGATGGATTAGCAAGAGCATGTGCTAAGGCTGGTGGGTTCCCAGAGCCAGAGATCATTCACTACAACCCTAAAGATTTTGATTTTGGGAAAAAGAAATCATTTCCATTCCGTGACCAGCATTTCTTTGCATCAGTTGAGAAAGCAAAGAGCGTGCTTGGATTGGAACCTGAATTTGGACTTGTAGAGGGTCTAGCAGACTCGTACAACCTGGACTTTGGTAGAGGAACATATCGGAAAGAGGCTGATTTCTCAACAGATGACATAATTCTTGGCAAGAGTCTTGTTAGCGTATAA
Predicted protein sequences of Glyma03g38930
>Glyma03g38930.1   sequence type=predicted peptide   gene model=Glyma03g38930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MARVVALQQNQLSFSTLASSLSDFSGTRLQTQLQFKRKQCHPKGSFYVSASSTKKILIMGGTRFIGVFLSRLLVKEGHQVTLFTRGKAPVTQQLPGESDSDYADFSSKILHLKGDRKDFDFVKSSLSAEGFDVVYDINGREADEVEPILDALPNLEQFIYCSSAGVYLKSDLLPHAETDAVDPKSRHKGKLETESLLQARGVNWTSIRPVYIYGPLNYNPVEEWFFHRLKAGRPIPIPGSGIQITQLGHVKDLAKAFIQVLGNEKASKEVFNISGDKYVTFDGLARACAKAGGFPEPEIIHYNPKDFDFGKKKSFPFRDQHFFASVEKAKSVLGLEPEFGLVEGLADSYNLDFGRGTYRKEADFSTDDIILGKSLVSV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo