SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g38780): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g38780): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g38780

Feature Type:gene_model
Chromosome:Gm03
Start:45071860
stop:45075344
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G09450AT Annotation by Michelle Graham. TAIR10: Protein kinase superfamily protein | chr1:3049066-3052858 FORWARD LENGTH=599 SoyBaseE_val: 4.00E-68ISS
GO:0006260GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication SoyBaseN/AISS
GO:0006270GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication initiation SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0008283GO-bp Annotation by Michelle Graham. GO Biological Process: cell proliferation SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0010389GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of G2/M transition of mitotic cell cycle SoyBaseN/AISS
GO:0016458GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing SoyBaseN/AISS
GO:0016570GO-bp Annotation by Michelle Graham. GO Biological Process: histone modification SoyBaseN/AISS
GO:0031047GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA SoyBaseN/AISS
GO:0034968GO-bp Annotation by Michelle Graham. GO Biological Process: histone lysine methylation SoyBaseN/AISS
GO:0035407GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-T11 phosphorylation SoyBaseN/AISS
GO:0048449GO-bp Annotation by Michelle Graham. GO Biological Process: floral organ formation SoyBaseN/AISS
GO:0048451GO-bp Annotation by Michelle Graham. GO Biological Process: petal formation SoyBaseN/AISS
GO:0048453GO-bp Annotation by Michelle Graham. GO Biological Process: sepal formation SoyBaseN/AISS
GO:0051225GO-bp Annotation by Michelle Graham. GO Biological Process: spindle assembly SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0051726GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle SoyBaseN/AISS
GO:0072355GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-T3 phosphorylation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0035402GO-mf Annotation by Michelle Graham. GO Molecular Function: histone kinase activity (H3-T11 specific) SoyBaseN/AISS
GO:0072354GO-mf Annotation by Michelle Graham. GO Molecular Function: histone kinase activity (H3-T3 specific) SoyBaseN/AISS
PTHR24419Panther INTERLEUKIN-1 RECEPTOR-ASSOCIATED KINASE JGI ISS
PTHR24419:SF203Panther JGI ISS
PF12330PFAM Domain of unknown function (DUF3635) JGI ISS
UniRef100_G7KWG0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Serine/threonine protein kinase haspin n=1 Tax=Medicago truncatula RepID=G7KWG0_MEDTR SoyBaseE_val: 4.00E-76ISS
UniRef100_I1JR20UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1JR20_SOYBN SoyBaseE_val: 3.00E-148ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g38780 not represented in the dataset

Glyma03g38780 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma19g41380 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g228700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g38780.2   sequence type=CDS   gene model=Glyma03g38780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTGTCTGCTCCAAGTGGTAAAGGATCTGAAGATATTGAAGCTGCTGTTAAGAAACTTTCTCTGGTATCAACGTCATCTTCAATGGATGATGACCAAATTAATCCATTTTCTGTTTTATTATCGATTTGTGGACAGTCTGCACCTTCAGTGTTACAAGATATTTTCTCTAGGGGAAATATACTTGTGGGCCGAAGTGATTCTGAAACGTTGCAGTTCACTCTCAATGGCAAGAATATGTTAATCAAAACGCATGGATTAATAATATCTATTATTGACTTCACTTTATCTACAATAAACACAGGTGATAGCATACTGTATTTAGATCTTTCCTCTGATCCTGACCTATTTAAAGGACCGAAAGGGGACAAACAGTCAGAAACATATCGGAGGATGAAGGAGGTGACTGAAGATTGCTGGGAAGGAAGCTGTCCTAAAACAAACGTGTTATGGTTGATCTACTTGGTAGACATACTCCTCATGAAGAAATCATTTGAACGTACTACAAAGCACGAGAGAGATCTACGATCCTTGAAGAAACGTCTTGACAAGTATGATTCGGCCAAGGAAGCAGTTCTTGACCCCTTCTTCACTGATTTGTTCATTGAGTCGGACCCAAAGGCTTAA

>Glyma03g38780.2   sequence type=predicted peptide   gene model=Glyma03g38780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLSAPSGKGSEDIEAAVKKLSLVSTSSSMDDDQINPFSVLLSICGQSAPSVLQDIFSRGNILVGRSDSETLQFTLNGKNMLIKTHGLIISIIDFTLSTINTGDSILYLDLSSDPDLFKGPKGDKQSETYRRMKEVTEDCWEGSCPKTNVLWLIYLVDILLMKKSFERTTKHERDLRSLKKRLDKYDSAKEAVLDPFFTDLFIESDPKA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo