SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g38630

Feature Type:gene_model
Chromosome:Gm03
Start:44932818
stop:44934641
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g38630
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G09560AT Annotation by Michelle Graham. TAIR10: germin-like protein 5 | chr1:3093896-3094639 FORWARD LENGTH=219 SoyBaseE_val: 7.00E-108ISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0006865GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid transport SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0010167GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitrate SoyBaseN/AISS
GO:0010497GO-bp Annotation by Michelle Graham. GO Biological Process: plasmodesmata-mediated intercellular transport SoyBaseN/AISS
GO:0015706GO-bp Annotation by Michelle Graham. GO Biological Process: nitrate transport SoyBaseN/AISS
GO:0034976GO-bp Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:2000280GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of root development SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0030145GO-mf Annotation by Michelle Graham. GO Molecular Function: manganese ion binding SoyBaseN/AISS
GO:0045735GO-mf Annotation by Michelle Graham. GO Molecular Function: nutrient reservoir activity SoyBaseN/AISS
PF00190PFAM Cupin JGI ISS
UniRef100_C7S8D5UniRef Annotation by Michelle Graham. Best UniRef hit: Germin-like protein 1 n=1 Tax=Glycine max RepID=C7S8D5_SOYBN SoyBaseE_val: 1.00E-153ISS
UniRef100_C7S8D5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Germin-like protein 1 n=1 Tax=Glycine max RepID=C7S8D5_SOYBN SoyBaseE_val: 1.00E-153ISS

Expression Patterns of Glyma03g38630
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g38630
ParalogEvidenceComments
Glyma19g41220 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g38630 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g227400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g38630
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g38630
>Glyma03g38630.1   sequence type=CDS   gene model=Glyma03g38630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGCTCACAGGTTTCCTGCAAGCGGTGACTCTTGCTTTGGTGTTAGCCACCGTCTCTGCATCAGATCCTGATCCTCTTCAAGACCTCTGTGTCGCAGACCTTGCTTCAGCGGTTAAAGTGAATGGATTCACATGCAAAGATGCTGCCAAGGTAAATGCGAGTGATTTCTTCTCAGACATACTAGCCAAACCAGGTGCCACAAACAACACCTATGGCTCCCTAGTGACTGGAGCCAACGTTCAGAAAATCCCAGGACTCAACACCCTTGGCGTGTCTTTATCACGCATTGACTATGCCCCAGGTGGCATCAACCCACCTCACACGCACCCACGTGCCACCGAGGTAGTGTTTGTGCTTGAAGGAACACTAGATGTTGGGTTCATAACCACAGCCAACGTGCTCATATCAAAGAGCATAAGCAAGGGTGAAATATTTGTGTTCCCAAAAGGGTTGGTTCACTTCCAAAAGAACAATGGAAAGGAACAAGCTTCAGTGATTGCAGCATTCAACAGTCAATTGCCTGGCACACAGTCCATTGCTCTAACGTTGTTTGCAGCGACGCCACCGGTTCCAGACAATGTGTTAACCAAGGCGTTCCAGGTGGGTACCAAGGAGGTTGAGAAAATTAAGTCTAGGCTTGCTCCTAAGAAATAA
Predicted protein sequences of Glyma03g38630
>Glyma03g38630.1   sequence type=predicted peptide   gene model=Glyma03g38630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKLTGFLQAVTLALVLATVSASDPDPLQDLCVADLASAVKVNGFTCKDAAKVNASDFFSDILAKPGATNNTYGSLVTGANVQKIPGLNTLGVSLSRIDYAPGGINPPHTHPRATEVVFVLEGTLDVGFITTANVLISKSISKGEIFVFPKGLVHFQKNNGKEQASVIAAFNSQLPGTQSIALTLFAATPPVPDNVLTKAFQVGTKEVEKIKSRLAPKK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo