SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g37540): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g37540): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g37540

Feature Type:gene_model
Chromosome:Gm03
Start:44136913
stop:44140665
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G05710AT Annotation by Michelle Graham. TAIR10: syntaxin of plants 43 | chr3:1685262-1687229 FORWARD LENGTH=330 SoyBaseE_val: 9.00E-159ISS
GO:0006886GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular protein transport SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0006891GO-bp Annotation by Michelle Graham. GO Biological Process: intra-Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007034GO-bp Annotation by Michelle Graham. GO Biological Process: vacuolar transport SoyBaseN/AISS
GO:0009306GO-bp Annotation by Michelle Graham. GO Biological Process: protein secretion SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:1900150GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of defense response to fungus SoyBaseN/AISS
GO:0005768GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endosome SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005802GO-cc Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network SoyBaseN/AISS
GO:0005484GO-mf Annotation by Michelle Graham. GO Molecular Function: SNAP receptor activity SoyBaseN/AISS
KOG0809 KOG SNARE protein TLG2/Syntaxin 16 JGI ISS
PTHR19957Panther SYNTAXIN JGI ISS
PTHR19957:SF57Panther SUBFAMILY NOT NAMED JGI ISS
PF00804PFAM Syntaxin JGI ISS
PF05739PFAM SNARE domain JGI ISS
UniRef100_B7X6S7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Syntaxin n=1 Tax=Nicotiana tabacum RepID=B7X6S7_TOBAC SoyBaseE_val: 9.00E-159ISS
UniRef100_UPI0002339BF3UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339BF3 related cluster n=1 Tax=unknown RepID=UPI0002339BF3 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g37540 not represented in the dataset

Glyma03g37540 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma19g40160 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g217400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g37540.1   sequence type=CDS   gene model=Glyma03g37540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGACGAGAAATCGAACTCTAGAGTTCAGAAAACACAGAGACGCCGTGAAAAGCGTGCGCGCTCCTCTCTCCTCCTCAGCATCTAGTCCTGTCATCGAAATGGTTACAACTTCGCTTCTTCCTTCTAATCGATCCTCCTATGCTCCTCTAAGCACCCAGGAACATGCTCCATCCACTTCTAGGGATGCGTTTACTGTGGGGTTGCCGCCATCTTGGGTGGATGATTCTGAAGAAATAGCTACAAATATACAACGTGCTAGGGTTAGAATTTCTGAGTTAACCAAAGCTCATGCGAAGGCTTTGATGCCTTCCTTTGGGGATGGCAAAGAGGATCAGCGTCATATTGAGACTCTCACCCAGGAAATTACTTCTCTCCTCAGAAAGTCTGAAGTGAGGCTCAAAAGACTTTCTGCCGCTGCTGGATCTTCTGAGGATTCTAATGTTAGAAAAAATGTTCAGCGTTCCCATGCTACAGATCTTCAGAACCTGTCAATGGATCTCCGGCGAAAACAGTCAGCATATTTGAAACATTTGCAGCAGCAACAAGAGGGTTATGATGGGGTTGACTTGGAGATGAACTTTAATGGGAGCAAATTTGTATCCCATAATGATGAATTCAGTGATGTGGGTTTTAGTGAAGAGCAAATGACCAAGCTAAAGAGAAGTGAGCAGTTCTCAGAGGAAAGGGAGAGAGAGATTGAACAGGTTGTCAAATCAGTCCATGAACTTGCTCAAATCATGAAGGATCTCTCTGTCCTTGTGATAGACCAGGGAACAATTGTGGATAGAATTGACTACAACATTCAGAGTGTTTCTACATCCGTTGAAGAGGGTCTTAAGCAGTTGCAAAAGGCAGAGAGAATACAGAAAAAAGGAGGGATGGTTATGTGTGCATCAACGCTTGTTATAATGTGCTTTGTCATGCTAGTTCTCTTGATACTCAAGGAGATTCTCTTCTAG

>Glyma03g37540.1   sequence type=predicted peptide   gene model=Glyma03g37540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATRNRTLEFRKHRDAVKSVRAPLSSSASSPVIEMVTTSLLPSNRSSYAPLSTQEHAPSTSRDAFTVGLPPSWVDDSEEIATNIQRARVRISELTKAHAKALMPSFGDGKEDQRHIETLTQEITSLLRKSEVRLKRLSAAAGSSEDSNVRKNVQRSHATDLQNLSMDLRRKQSAYLKHLQQQQEGYDGVDLEMNFNGSKFVSHNDEFSDVGFSEEQMTKLKRSEQFSEEREREIEQVVKSVHELAQIMKDLSVLVIDQGTIVDRIDYNIQSVSTSVEEGLKQLQKAERIQKKGGMVMCASTLVIMCFVMLVLLILKEILF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo