SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g36780

Feature Type:gene_model
Chromosome:Gm03
Start:43639899
stop:43642624
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g36780
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G03180AT Annotation by Michelle Graham. TAIR10: CONTAINS InterPro DOMAIN/s: rRNA processing (InterPro:IPR013730); Has 898 Blast hits to 687 proteins in 142 species: Archae - 2; Bacteria - 28; Metazoa - 200; Fungi - 99; Plants - 63; Viruses - 0; Other Eukaryotes - 506 (source: NCBI BLink). | chr4:1403289-1404663 FORWARD LENGTH=185 SoyBaseE_val: 1.00E-42ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF08524PFAM rRNA processing JGI ISS
UniRef100_I1JQH0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JQH0_SOYBN SoyBaseE_val: 1.00E-131ISS
UniRef100_Q2QP93UniRef Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=1 Tax=Oryza sativa Japonica Group RepID=Q2QP93_ORYSJ SoyBaseE_val: 6.00E-29ISS

Expression Patterns of Glyma03g36780
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g36780
ParalogEvidenceComments
Glyma19g39440 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g36780 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g209500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g36780
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g36780
>Glyma03g36780.1   sequence type=CDS   gene model=Glyma03g36780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGAAGAACGAGGAACGCAGCGATAATCAGAGCATGAAGAAGAAACAAATAATGATGAAGAAGAAGAACGTTTCGAGGTTGGGCGGAAGTGGCCTTTCGCTCAACGCTTTCGCCAACGCAAAATTCAAGAACAATCACTATAACCCAGCCATCATAAAGAAGCAAAGGGAGTTCTATAAAAATGCTAAGAATGTGAATAAGTTTAAGAAGTTGGTAAAGCAGCAAAACCAGCAGAATGAACCCTCTTTGGCTCAGAGACATATAGAGAATGTAAATGAAACTGAAGAGAACAAGGACGATAGTGAGAGGAGGAAGAGGAAGAATAGTGCCCTTAGTTTGGAAGAGTTGTACAAGAAGCAGCATGAAGAGAAGGAGAAAGAAATAATGGAGAGAGAGGCTGTCCTGAGGGTAAAGAAGGAAGAGAGAGAACAAGCTGAAGCTCGGAGAAAGGCTATGCGAGAAAAAATGCTTAAGAAGACACGAAAAGGGCAGCCTGTTATGAAATACAGAATTGAGCATCTCTTGGAGACTATTCAAGGTTCAACTAAAAATGCAGCTGGCAGTAAATCCTGA
Predicted protein sequences of Glyma03g36780
>Glyma03g36780.1   sequence type=predicted peptide   gene model=Glyma03g36780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKKNEERSDNQSMKKKQIMMKKKNVSRLGGSGLSLNAFANAKFKNNHYNPAIIKKQREFYKNAKNVNKFKKLVKQQNQQNEPSLAQRHIENVNETEENKDDSERRKRKNSALSLEELYKKQHEEKEKEIMEREAVLRVKKEEREQAEARRKAMREKMLKKTRKGQPVMKYRIEHLLETIQGSTKNAAGSKS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo