SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g36420

Feature Type:gene_model
Chromosome:Gm03
Start:43383475
stop:43384940
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g36420
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G03850AT Annotation by Michelle Graham. TAIR10: Nucleic acid-binding, OB-fold-like protein | chr5:1028542-1028736 REVERSE LENGTH=64 SoyBaseE_val: 9.00E-34ISS
GO:0006407GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA export from nucleus SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0042254GO-bp Annotation by Michelle Graham. GO Biological Process: ribosome biogenesis SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0022627GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic small ribosomal subunit SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG3502 KOG 40S ribosomal protein S28 JGI ISS
PTHR10769Panther RIBOSOMAL PROTEIN S28 JGI ISS
PF01200PFAM Ribosomal protein S28e JGI ISS
UniRef100_G7KLD3UniRef Annotation by Michelle Graham. Most informative UniRef hit: 30S ribosomal protein S28e n=2 Tax=Medicago truncatula RepID=G7KLD3_MEDTR SoyBaseE_val: 3.00E-37ISS
UniRef100_I1JQD4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JQD4_SOYBN SoyBaseE_val: 1.00E-38ISS

Expression Patterns of Glyma03g36420
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g36420
ParalogEvidenceComments
Glyma19g39070 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g36420 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g205800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g36420
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g36420
>Glyma03g36420.1   sequence type=CDS   gene model=Glyma03g36420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGGAGTCTCAGGTGAAGCATGCTCTTGTTGTCAAAGTTATGGGTCGTACTGGATCCAGAGGACAGGTGACTCAGGTTAGAGTGAAGTTTTTGGATGATCAGAACCGTCATATCATGAGGAATGTTAAAGGACCAGTGAGAGAAGGAGACATTCTCACCCTACTCGAGTCTGAAAGGGAAGCAAGAAGGTTGCGCTAG
Predicted protein sequences of Glyma03g36420
>Glyma03g36420.1   sequence type=predicted peptide   gene model=Glyma03g36420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMESQVKHALVVKVMGRTGSRGQVTQVRVKFLDDQNRHIMRNVKGPVREGDILTLLESEREARRLR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo