Glyma03g36130 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g36130

Feature Type:	gene_model
Chromosome:	Gm03
Start:	43156497
stop:	43159087
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma03g36130

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G52380	AT	Annotation by Michelle Graham. TAIR10: chloroplast RNA-binding protein 33 \| chr3:19421619-19422855 FORWARD LENGTH=329	SoyBase	E_val: 1.00E-99	ISS
GO:0009793	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy	SoyBase	N/A	ISS
GO:0010027	GO-bp	Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization	SoyBase	N/A	ISS
GO:0010228	GO-bp	Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem	SoyBase	N/A	ISS
GO:0016226	GO-bp	Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly	SoyBase	N/A	ISS
GO:0019288	GO-bp	Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway	SoyBase	N/A	ISS
GO:0048481	GO-bp	Annotation by Michelle Graham. GO Biological Process: ovule development	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0009579	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: thylakoid	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0003676	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding	SoyBase	N/A	ISS
GO:0003723	GO-mf	Annotation by Michelle Graham. GO Molecular Function: RNA binding	SoyBase	N/A	ISS
KOG0131	KOG	Splicing factor 3b, subunit 4	JGI		ISS
PTHR24012	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24012:SF56	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00076	PFAM	RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)	JGI		ISS
UniRef100_I1JQ98	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JQ98_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q08948	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 33 kd chloroplast ribonucleoprotein n=1 Tax=Nicotiana sylvestris RepID=Q08948_NICSY	SoyBase	E_val: 2.00E-104	ISS

Expression Patterns of Glyma03g36130

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g36130

Paralog	Evidence	Comments
Glyma19g38790	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g36130 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.03g202900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma03g36130

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma03g36130

Limit To All Plant Sequences

>Glyma03g36130.1   sequence type=CDS   gene model=Glyma03g36130   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGCTGTTTCCTCTTCTATCTGCAACAGAATATACAACCTTTCCTTCACACACCCTTCCCTTTCACTCACCACCTGCAACTTCCGTCAAAGACCCATATCCCAAAAACCATTCACTCTCAACCTCAAGTCCCAAAGTTTCACTCTTTCCTTTTTCCCACTTCACCGTCTTCCCCCTCCTTCCGCTGCCTTCGATGGGTTTGAAGTAGCTCAAGACACCACAGAGTTCCAACAAGACGAACCAGAAACAGAACCTGTGGAAAAAACAGAACAAGAGGAAGAGCAAAAGGTTTCTGATTCATACGATGCTGGGAGGCTCTATGTTGGAAACTTGCCATATTCAATCACTAATTCCGCATTGGCTGAGCTCTTTGGAGAAGCTGGCACCGTGGCGTCTGTTGAGATTATGTATGATCGTGTCACGGACAGAAGCAGGGGATTTGCATTTGTTACAATGGGGAATGTTGAGGATGCTAAAGAGGCAATTCGAATGTTTGATGGCTCGCAAGTTGGTGGTAGGACTGTTAAGGTAAACTTCCCAGAGGTACCCAAAGGAGGGGAAAGGTTGGTAATGGGGTCCAAAATACGGAACAGTTACAGAGGTTTTGTAGACAGCCCTCACAAGATCTATGCTGGAAACCTTGGCTGGGGACTGACCTCACAGGGTCTTAGGGAAGCTTTTGCTGAGCAGCCAGGCGTATTGAGTGCCAAGGTCATCTATGAGAGGGACAGTGGAAGATCTCGAGGTTTTGGGTTTGTTTCTTTTGAAACTGCTGAATCTGCACAGGCTGCTTTGGACATTATGAATGGTGTGGAGGTACAAGGTCGGCCCTTGCGGTTGAATTTGGCTGAAGCAAGGGCACCTTCATCTCCTCCAGTAATTCAGAAAAATGTAGGAAGCAATGTTGAAAGCTCGGAATTGGTGTCTAGTGCCAGCACATAA

Predicted protein sequences of Glyma03g36130

Limit To All Plant Sequences

>Glyma03g36130.1   sequence type=predicted peptide   gene model=Glyma03g36130   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAAVSSSICNRIYNLSFTHPSLSLTTCNFRQRPISQKPFTLNLKSQSFTLSFFPLHRLPPPSAAFDGFEVAQDTTEFQQDEPETEPVEKTEQEEEQKVSDSYDAGRLYVGNLPYSITNSALAELFGEAGTVASVEIMYDRVTDRSRGFAFVTMGNVEDAKEAIRMFDGSQVGGRTVKVNFPEVPKGGERLVMGSKIRNSYRGFVDSPHKIYAGNLGWGLTSQGLREAFAEQPGVLSAKVIYERDSGRSRGFGFVSFETAESAQAALDIMNGVEVQGRPLRLNLAEARAPSSPPVIQKNVGSNVESSELVSSAST*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain