SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g36120

Feature Type:gene_model
Chromosome:Gm03
Start:43149469
stop:43152810
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g36120
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G11820AT Annotation by Michelle Graham. TAIR10: syntaxin of plants 121 | chr3:3729540-3730775 REVERSE LENGTH=315 SoyBaseE_val: 2.00E-107ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006820GO-bp Annotation by Michelle Graham. GO Biological Process: anion transport SoyBaseN/AISS
GO:0006862GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide transport SoyBaseN/AISS
GO:0006886GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular protein transport SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0007154GO-bp Annotation by Michelle Graham. GO Biological Process: cell communication SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009620GO-bp Annotation by Michelle Graham. GO Biological Process: response to fungus SoyBaseN/AISS
GO:0009625GO-bp Annotation by Michelle Graham. GO Biological Process: response to insect SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009963GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process SoyBaseN/AISS
GO:0010119GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of stomatal movement SoyBaseN/AISS
GO:0010148GO-bp Annotation by Michelle Graham. GO Biological Process: transpiration SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0015696GO-bp Annotation by Michelle Graham. GO Biological Process: ammonium transport SoyBaseN/AISS
GO:0015802GO-bp Annotation by Michelle Graham. GO Biological Process: basic amino acid transport SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:0043269GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of ion transport SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0045087GO-bp Annotation by Michelle Graham. GO Biological Process: innate immune response SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051245GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of cellular defense response SoyBaseN/AISS
GO:0051707GO-bp Annotation by Michelle Graham. GO Biological Process: response to other organism SoyBaseN/AISS
GO:0072660GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of protein location in plasma membrane SoyBaseN/AISS
GO:0005802GO-cc Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009504GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell plate SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0031201GO-cc Annotation by Michelle Graham. GO Cellular Compartment: SNARE complex SoyBaseN/AISS
GO:0005484GO-mf Annotation by Michelle Graham. GO Molecular Function: SNAP receptor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0043495GO-mf Annotation by Michelle Graham. GO Molecular Function: protein anchor SoyBaseN/AISS
KOG0810 KOG SNARE protein Syntaxin 1 and related proteins JGI ISS
PTHR19957Panther SYNTAXIN JGI ISS
PTHR19957:SF26Panther SYNTAXIN, ARABIDOPSIS THALIANA JGI ISS
PF00804PFAM Syntaxin JGI ISS
PF05739PFAM SNARE domain JGI ISS
UniRef100_B7FI20UniRef Annotation by Michelle Graham. Most informative UniRef hit: Syntaxin-121 n=2 Tax=Medicago truncatula RepID=B7FI20_MEDTR SoyBaseE_val: 5.00E-120ISS
UniRef100_I1JQ97UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JQ97_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma03g36120
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g36120
ParalogEvidenceComments
Glyma19g38770 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g36120 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g202800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g36120
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g36120
>Glyma03g36120.1   sequence type=CDS   gene model=Glyma03g36120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAACGACTTGTTATCAGGTTTGTTCTCAAAGGGAAAACAAGAAGAGCATGTGATTGAGATAACAGAAGGTGGTGGCATAATGGAGTTGGAGAAGTTCTTGGAAGAAGTGGAATCAGTGAAGGAGGACTTGAAGGAGCTAGAGCGTCTCCACCTAAGCCTTGATGCTACAAACCAAAACGGAAAAGCGCTTCACAGCCCAAAGGGCGTTAGGGAGCTACGGTCTCGCATGGACCTGGACGTGGCTCTCTCTCTCACCAAAGCCAAGCACGTCAAGGGTCGCTTGGCGGCTCTCCACCGTGCCAACCAAGCCACCCTCTCCTTGCCCGATTGCGGGCCCGGTTCATACTCCGACCGGACCCGAACCGCGCTGGTGGGGGCCTTGACCAAGAACCTTAGACAGTCCATGGCGAGTTTCAATAAGCTGAGGGAGCAGATATCGTACGAGTACAGAGACACCGTGCAACGTAGATACTACGCTGTCACTGGAGAGAACCCTGATCAAGAAACCATCGACCTCCTCATCTCTACGGGTGAGAGCGAAACATTCTTACAGAAAGCCATCCAACAGCAAGGGAGAGCCAGTGTCATGGACACAATCCAAGAGATTCGAGAGAGGCACGGCACGATGAAAGAGATAGAGAGAAGCCTACACGAGCTGCACCAAGTGTTCATGGACATGGCAGTGTTGATCCAACACCAGGGTGAACACTTGGATGACATAGAGAGCCACGTGGAACTCGCAAACTCCTTCGTGAGCAAAGGGGTACAGCATTTGCAGGTCGTGAGGAATCATCAGAAGAACACCCGTAACTTCACTTGTTTCGCCGTTCTGCTCTTCATCATCGTGTTGGTCATAATTCTCCCTATTGTTTTCAGAAATTGA
Predicted protein sequences of Glyma03g36120
>Glyma03g36120.1   sequence type=predicted peptide   gene model=Glyma03g36120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNDLLSGLFSKGKQEEHVIEITEGGGIMELEKFLEEVESVKEDLKELERLHLSLDATNQNGKALHSPKGVRELRSRMDLDVALSLTKAKHVKGRLAALHRANQATLSLPDCGPGSYSDRTRTALVGALTKNLRQSMASFNKLREQISYEYRDTVQRRYYAVTGENPDQETIDLLISTGESETFLQKAIQQQGRASVMDTIQEIRERHGTMKEIERSLHELHQVFMDMAVLIQHQGEHLDDIESHVELANSFVSKGVQHLQVVRNHQKNTRNFTCFAVLLFIIVLVIILPIVFRN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo