SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g35660

Feature Type:gene_model
Chromosome:Gm03
Start:42793151
stop:42794158
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g35660
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G27310AT Annotation by Michelle Graham. TAIR10: F-box family protein | chr2:11683954-11684967 REVERSE LENGTH=337 SoyBaseE_val: 2.00E-74ISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009693GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene biosynthetic process SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009873GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010286GO-bp Annotation by Michelle Graham. GO Biological Process: heat acclimation SoyBaseN/AISS
GO:0035556GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_B9MYU0UniRef Annotation by Michelle Graham. Most informative UniRef hit: F-box family protein n=1 Tax=Populus trichocarpa RepID=B9MYU0_POPTR SoyBaseE_val: 2.00E-88ISS
UniRef100_UPI0002337299UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002337299 related cluster n=1 Tax=unknown RepID=UPI0002337299 SoyBaseE_val: 0ISS

Expression Patterns of Glyma03g35660
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g35660
ParalogEvidenceComments
Glyma19g38290 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g35660 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g198600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g35660
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g35660
>Glyma03g35660.1   sequence type=CDS   gene model=Glyma03g35660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTGCACTGATAAAACGGCCACCGTCACCGACGAAGCTAGCGGCGGCGGAGCCACTACAATCTTCGCCGTGCACCCCGACATAATCCAAACCCACATCCTCACGTGCCTGGACGGTCGCGCACTCGCCTCCGTCGCCAGCACGTGCTCTCAACTCCACGCGCTCTCAGACCACGAGCCTCTCTGGGAGAACATTTGCCACTCCACGTGGCCCTCCACGAACTCGCCACGCGTCCGCCACGTCATATCCACGTTCCCATGCGCGTCTCGCTCCTTTTTCTCCGACTCGTTTCCTTCCTTCGCCGCGCGCGAAGGTTCGAACATCGATCGCGCGCCGGAGCTGATTTCCGCGGTGGACATCTTCCACCGGCGGCGGGTGGTGCTGTCGAGAGTGGTGGAGACGGAGACGGAGTCCGGCTGGTTCCGGTGCTCGCCGTTTAGAATCGATGTTCTTGATCAGAAGGAGGCGGTGGCGACGGCGATGGAGTATCCACTGAGCGATGGAGCATGTGAGATTCTCGGTGAGGATTTGAGGTTGAGTTGGATAGTGGTGAATCCGAAGGGAAAGCGTGCGGTGAATGTGTCAAGTGGAACGGCGGTGTCGGTGGAGCGGCACTGGCTGAGCGGGGAGGTGAAGGTGCGGTTCGCGACGGTGGTGGACGGCGGTGAGAGGGGGACGCCGGCGGAGGTGGCGCTGTGCAGCGTGACTGTGACATTCGGGAATGAGATGCAGGTGAGGGAAGCGTGTCTACAGATGGAGGACATGGATGGAATGTTCCTGAATGGTAGGGAGAGTTTGGGGATTTTGAAGCGGGCGTTGGAGGGTAAAAGGGGAACATTACTGAAGGACGGAAAGGAAGAAGGAAGGAGTAGATACTTGGAATTCATGAACAGAAAGATGGAGAGAAAAGAAAAGAAACAAAGAGATGAGAGGAGGTTGGATATGCTCTGCTTGGCTCTCGCGGTTTTGTCCTTTGCGGCTTTTTCAACACTCTTTCTCTTCTGA
Predicted protein sequences of Glyma03g35660
>Glyma03g35660.1   sequence type=predicted peptide   gene model=Glyma03g35660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MACTDKTATVTDEASGGGATTIFAVHPDIIQTHILTCLDGRALASVASTCSQLHALSDHEPLWENICHSTWPSTNSPRVRHVISTFPCASRSFFSDSFPSFAAREGSNIDRAPELISAVDIFHRRRVVLSRVVETETESGWFRCSPFRIDVLDQKEAVATAMEYPLSDGACEILGEDLRLSWIVVNPKGKRAVNVSSGTAVSVERHWLSGEVKVRFATVVDGGERGTPAEVALCSVTVTFGNEMQVREACLQMEDMDGMFLNGRESLGILKRALEGKRGTLLKDGKEEGRSRYLEFMNRKMERKEKKQRDERRLDMLCLALAVLSFAAFSTLFLF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo