SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma03g35540

Feature Type:gene_model
Chromosome:Gm03
Start:42704358
stop:42705673
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G52590AT Annotation by Michelle Graham. TAIR10: ubiquitin extension protein 1 | chr3:19505668-19506681 FORWARD LENGTH=128 SoyBaseE_val: 7.00E-91ISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG0003 KOG Ubiquitin/60s ribosomal protein L40 fusion JGI ISS
PTHR10666Panther UBIQUITIN JGI ISS
PF00240PFAM Ubiquitin family JGI ISS
PF01020PFAM Ribosomal L40e family JGI ISS
UniRef100_B3TLP6UniRef Annotation by Michelle Graham. Best UniRef hit: Ubiquitin fusion protein n=9 Tax=Spermatophyta RepID=B3TLP6_ELAGV SoyBaseE_val: 5.00E-89ISS
UniRef100_B3TLP6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ubiquitin fusion protein n=9 Tax=Spermatophyta RepID=B3TLP6_ELAGV SoyBaseE_val: 5.00E-89ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma19g38170 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g197600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g35540.2   sequence type=CDS   gene model=Glyma03g35540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCACTGGGTTGCAGGGTTAGCATTAGTTCTCTGGAAGAGGAGTGAAGCAGCAGAGGGAGGAGCGGCATTAAAAATGCAGATCTTCGTGAAAACCCTAACGGGGAAGACCATAACCCTCGAGGTCGAAAGCAGCGACACCATTGACAATGTCAAGGCTAAGATTCAAGACAAGGAAGGCATCCCTCCGGATCAGCAGCGTTTGATTTTCGCCGGAAAGCAACTTGAAGATGGAAGGACCTTGGCCGATTACAACATCCAGAAGGAATCAACCCTTCACCTTGTCCTCAGGCTTCGTGGTGGCATCATCGAGCCTTCCCTCATGGCTTTGGCTCGCAAATACAACCAGGACAAGATGATTTGCCGCAAATGCTATGCTCGTCTGCACCCTAGGGCTGTGAACTGCCGTAAGAAGAAGTGCGGTCATAGTAACCAGTTGAGGCCTAAGAAGAAGATCAAGTAA

>Glyma03g35540.2   sequence type=predicted peptide   gene model=Glyma03g35540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MHWVAGLALVLWKRSEAAEGGAALKMQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGIIEPSLMALARKYNQDKMICRKCYARLHPRAVNCRKKKCGHSNQLRPKKKIK*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo