SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g34960

Feature Type:gene_model
Chromosome:Gm03
Start:42248980
stop:42252542
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g34960
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G03680AT Annotation by Michelle Graham. TAIR10: Duplicated homeodomain-like superfamily protein | chr5:957858-960760 FORWARD LENGTH=591 SoyBaseE_val: 4.00E-138ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007389GO-bp Annotation by Michelle Graham. GO Biological Process: pattern specification process SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009944GO-bp Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0010075GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0046621GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of organ growth SoyBaseN/AISS
GO:0048438GO-bp Annotation by Michelle Graham. GO Biological Process: floral whorl development SoyBaseN/AISS
GO:0048439GO-bp Annotation by Michelle Graham. GO Biological Process: flower morphogenesis SoyBaseN/AISS
GO:0048441GO-bp Annotation by Michelle Graham. GO Biological Process: petal development SoyBaseN/AISS
GO:0048442GO-bp Annotation by Michelle Graham. GO Biological Process: sepal development SoyBaseN/AISS
GO:0048451GO-bp Annotation by Michelle Graham. GO Biological Process: petal formation SoyBaseN/AISS
GO:0048453GO-bp Annotation by Michelle Graham. GO Biological Process: sepal formation SoyBaseN/AISS
GO:0048498GO-bp Annotation by Michelle Graham. GO Biological Process: establishment of petal orientation SoyBaseN/AISS
GO:0048519GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process SoyBaseN/AISS
GO:0090428GO-bp Annotation by Michelle Graham. GO Biological Process: perianth development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
KOG4282 KOG Transcription factor GT-2 and related proteins, contains trihelix DNA-binding/SANT domain JGI ISS
UniRef100_B9SRH5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor, putative n=1 Tax=Ricinus communis RepID=B9SRH5_RICCO SoyBaseE_val: 0ISS
UniRef100_UPI0002339604UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339604 related cluster n=1 Tax=unknown RepID=UPI0002339604 SoyBaseE_val: 0ISS

Expression Patterns of Glyma03g34960
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g34960
ParalogEvidenceComments
Glyma19g37660 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g34960 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g191700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g34960
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g34960
>Glyma03g34960.1   sequence type=CDS   gene model=Glyma03g34960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAATGGAGGACCATCATCGTCACCATCATCAGTATGGCATCACTGATCTGAGGCAACTCGTTAACGGCCCTCGGCCGACTCATTTCCCCACCATGCCGCCACCGCCCAAGGCGGAGCTGTTCCCCGGCGACTCCAACCTGCAGGCTGCGACACAACAACACTACGAGATGATGATGTTTGGTCGTCAAGTAGCCGACATAATGCCTCCTCGTTGTCTTCATGACTTCGCCTCCACCGATTCCGCCACCAACATCGCCGTTGCCACTCCCACCACCACCCCTAGCGCCTCCACTCCTCCGCTTAGTTGCTTAGAGGCCGAGACCGCAGGATGCATCGGTGGAGACGCCTCCACTGGAAGATGGCCCAGACAAGAGACTCTCACTCTCCTTGAGATCAGATCTCGCCTCGACTCTAAATTCAAAGAGGCTAATCAAAAGGGTCCCTTATGGGATGAAGTTTCTAGGAACATGTCTGAAGAACATGGATATCAAAGGAGTGGGAAAAAGTGCAGGGAGAAGTTTGAGAACCTGTACAAATATTACAAGAAGACAAAGGAAGGAAAAGCTGGAAGACAAGATGGGAAGCATTACAGGTTCTTTCGTCAACTTGAAGCCTTATATGGTGAAAACAGTAACCAAGCCTCGGTGCCAGAAACCAATTTTGGCAGTGGTAGCCTTCGTTTCCACACAAGCAGCCACAATAATAACCCTTCTCAAACAAATCAAGAAATGTTTCAGTCTCAGAAGCATTGTGACAGCCTAAGCCTCACCAACTCCACTGATTTGGACACTTCATCATCGGATGACAATGATCAAAATAGCACTGGCAGGGAACTCAACAAGGACAATGACTCCATGGAGAAGAGGAGAAAGAGGGTGAGTGGAAGAAGCTGGAAGGTGAAGATAAAGGACTTCATTGACTCACAGATGAGGAAGCTGGTGGAGAAGCAAGAGGAGTGGTTGGATAAACTCACAAAGACACTGGAACAGAAGGAAAAAGAGAGAGTGTTAAGAGAAGAAGAGTGGAGGAGACAAGAATCTGTAAGGTTGGAGAGGGAACACAAATTTTGGGCTAAAGAGAGAGCATGGATTGAAGCAAGGGATGCTGCTTTAATGGAGGCTTTGCACAAATTAACACGAAATGAGATAATGAAGAGTACTCATTCTCACGAGGGTCTAATGGTAACTGGAATTCAAATCCACAGTGAAAACCAGAATGAAGATGGGAGTGAAATACTAAATAGCACTGCTGCCAGAGGTGCTGAAAGCTGGCCAGAATCTGAGATTGCAAGGCTTCAACAGTTGAGAGCTGAGATGGAGACAAGGTATATGCAAAGTGGGTTTTCAGAAGAGGTTATGTGGGAGGAAATAGCTACCAAAATGGCTTGTTTTGGTTACGAAAGGAGTGCTTTGGTATTCAAAGAGAAATGGGAAAGTATAAGCAGCAACTATGCAAGGAGTGCCAAGGATGGAAGCAAGAAGCGCAAGGAAGACTCAAGAAGTTGTTTTTACTTCGATAACAGTGACCAATCTTCTCTGTATAACCAAGGAGGTGCCTATTGTGATATCAATGATCAAAGGCACGAGACTGGGAGGCTGCAAACAAATGACGGTTCTTCACCTTCCAATTCAAATGTTGGAAATGCAGTTGCGGGTGATAACTGCTTTCCCTTCTTGATGACTGAGGGTGGAAATTTGTGGGAGAACTATAGCTTAAAGGTTAATAAAGCATGCCAAAACCAGTGA
Predicted protein sequences of Glyma03g34960
>Glyma03g34960.1   sequence type=predicted peptide   gene model=Glyma03g34960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEMEDHHRHHHQYGITDLRQLVNGPRPTHFPTMPPPPKAELFPGDSNLQAATQQHYEMMMFGRQVADIMPPRCLHDFASTDSATNIAVATPTTTPSASTPPLSCLEAETAGCIGGDASTGRWPRQETLTLLEIRSRLDSKFKEANQKGPLWDEVSRNMSEEHGYQRSGKKCREKFENLYKYYKKTKEGKAGRQDGKHYRFFRQLEALYGENSNQASVPETNFGSGSLRFHTSSHNNNPSQTNQEMFQSQKHCDSLSLTNSTDLDTSSSDDNDQNSTGRELNKDNDSMEKRRKRVSGRSWKVKIKDFIDSQMRKLVEKQEEWLDKLTKTLEQKEKERVLREEEWRRQESVRLEREHKFWAKERAWIEARDAALMEALHKLTRNEIMKSTHSHEGLMVTGIQIHSENQNEDGSEILNSTAARGAESWPESEIARLQQLRAEMETRYMQSGFSEEVMWEEIATKMACFGYERSALVFKEKWESISSNYARSAKDGSKKRKEDSRSCFYFDNSDQSSLYNQGGAYCDINDQRHETGRLQTNDGSSPSNSNVGNAVAGDNCFPFLMTEGGNLWENYSLKVNKACQNQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo