SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g34840

Feature Type:gene_model
Chromosome:Gm03
Start:42138835
stop:42141614
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g34840
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G42820AT Annotation by Michelle Graham. TAIR10: Zinc finger C-x8-C-x5-C-x3-H type family protein | chr5:17170445-17171296 REVERSE LENGTH=283 SoyBaseE_val: 2.00E-119ISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0048573GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG2202 KOG U2 snRNP splicing factor, small subunit, and related proteins JGI ISS
PTHR12620Panther U2 SNRNP AUXILIARY FACTOR, SMALL SUBUNIT JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
PF00642PFAM Zinc finger C-x8-C-x5-C-x3-H type (and similar) JGI ISS
UniRef100_I1JPW6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JPW6_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q99L29UniRef Annotation by Michelle Graham. Most informative UniRef hit: cDNA sequence BC003883 n=1 Tax=Mus musculus RepID=Q99L29_MOUSE SoyBaseE_val: 2.00E-148ISS

Expression Patterns of Glyma03g34840
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g34840
ParalogEvidenceComments
Glyma19g37530 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g34840 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g190600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g34840
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g34840
>Glyma03g34840.1   sequence type=CDS   gene model=Glyma03g34840   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGAGCACTTGGCATCGATATTCGGGACGGAGAAGGACAGGGTGAACTGTCCGTTCTACTTCAAGATCGGCGCGTGCAGGCACGGCGACCGGTGCTCCCGGCTTCACACCAAGCCGACAATTAGCCCAACATTGGTTCTGTCGAACATGTACCAGAGGCCCGACATGAACATGAGCATTATCACCAACCCCGATCAGCCACAACCCCAATCCCTTGACCCCGACAAGGTGCAGGATCACTTCGACGACTTCTACGAAGATCTCTTCGAGGAGCTCAGCAAGTACGGCCCCATTCAGAGCTTGAATATTTGTGACAACCTCGCCGATCACATGGTTGGGAATGTGTATGTTCAGTTTAGGGAGGAAGATCATGCTGCCAACGCCCTCATGAATCTCACTGGGAGGTTTTATTCAGGTCGTCCCATCATTGTTGACTTCTCTCCCGTTACGGATTTTCGAGAAGCTACTTGTAGGCAGTATGAGGAAAATGTATGCAATAGAGGTGGCTATTGCAACTTCATGCACCTAAAGAAGATTAGCAGGGATTTGAGAAGGAAATTATTTGGAAGAAATAGGCGATGGAATGGCCGCAGTGGAAGCAGAAGCAGGAGCCCTCCAAGGAATCGTAACCATGGGGAGAATTCACATTCTGGTCGTGGTTCTGGTAGAAGAGATTTTGACAGGTCCCATGGCCCCCATGGTAGGAGGCCTAGAAGCCGTAGTCCTCGGTATAGAGGAAAACGAAGTAGAAGTCCAGTGGGCAGAGATAGGAGTCCTCCGATCAGAGAAAGTAGTGCAGAAAGGAGAGCTAAAATAGAGCAATGGAACAGGGAGAAGGAACAAGGGGACACTGGTAACATGAACAATTCGAAAAGCAGTGATGATTATCAAGAACAGAGTGTTGCACAAAATGGTAGTGAATCTGGTAACCATCAGATATAG
Predicted protein sequences of Glyma03g34840
>Glyma03g34840.1   sequence type=predicted peptide   gene model=Glyma03g34840   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEHLASIFGTEKDRVNCPFYFKIGACRHGDRCSRLHTKPTISPTLVLSNMYQRPDMNMSIITNPDQPQPQSLDPDKVQDHFDDFYEDLFEELSKYGPIQSLNICDNLADHMVGNVYVQFREEDHAANALMNLTGRFYSGRPIIVDFSPVTDFREATCRQYEENVCNRGGYCNFMHLKKISRDLRRKLFGRNRRWNGRSGSRSRSPPRNRNHGENSHSGRGSGRRDFDRSHGPHGRRPRSRSPRYRGKRSRSPVGRDRSPPIRESSAERRAKIEQWNREKEQGDTGNMNNSKSSDDYQEQSVAQNGSESGNHQI*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo