SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g34830

Feature Type:gene_model
Chromosome:Gm03
Start:42131866
stop:42136472
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g34830
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G36530AT Annotation by Michelle Graham. TAIR10: Enolase | chr2:15321081-15323786 REVERSE LENGTH=444 SoyBaseE_val: 0ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0000015GO-cc Annotation by Michelle Graham. GO Cellular Compartment: phosphopyruvate hydratase complex SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005740GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial envelope SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0000287GO-mf Annotation by Michelle Graham. GO Molecular Function: magnesium ion binding SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0004634GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphopyruvate hydratase activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
KOG2670 KOG Enolase JGI ISS
PTHR11902Panther ENOLASE JGI ISS
PF00113PFAM Enolase, C-terminal TIM barrel domain JGI ISS
PF03952PFAM Enolase, N-terminal domain JGI ISS
UniRef100_I1JPW5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JPW5_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q6RIB7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Enolase n=1 Tax=Glycine max RepID=Q6RIB7_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma03g34830
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g34830
ParalogEvidenceComments
Glyma19g37520 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g34830 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g190500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g34830
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g34830
>Glyma03g34830.1   sequence type=CDS   gene model=Glyma03g34830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTACCATTGTTAGCATCAAGGCCCGCCAGATCTTTGACAGTCGTGGCAATCCAACCGTCGAGGTGGATTTGACATGCTCCGATGGTACTTTTGCTAGAGCTGCTGTTCCAAGTGGTGCATCCACTGGGATTTATGAGGCCCTTGAATTGAGAGATGGAGGATCTGACTACCTTGGAAAGGGTGTATCAAAGGCTGTTGACAATGTGAACACCATTATTGCCCCTGCTTTGGTTGGCAAGGACCCAACTCAGCAGACTGCTATTGACAACTTAATGGTTCAACAACTTGATGGAACTGTTAACGAATGGGGTTGGTGCAAGCAAAAGCTTGGAGCAAATGCCATATTGGCAGTGTCTCTTGCAGTCTGCAAAGCTGGTGCTGCTGTCCTGAAAGTTCCTCTTTACAAGCATATTGCAAATATTGCGGGTAACAAAAAGTTGGTTTTGCCTGTTCCTGCTTTCAATGTCATTAATGGTGGATCACATGCTGGAAACAAACTTGCTATGCAGGAGTTTATGGTTCTTCCCGTGGGAGCTTCCTCTTTCAAGGAAGCCATGAAGATGGGTGTAGAAGTATATCACAATTTGAAGTCTGTGATTAAGAAGAAATATGGTCAAGATGCAGTAAATGTTGGTGACGAAGGTGGCTTTGCCCCTAACATCCAGGAAAACAAGGAAGGTTTGGAATTGCTGAAAACTGCCATTGCCAAAGCTGGTTACACAGGCAAAGTTGTCATTGGAATGGATGTTGCAGCTTCTGAATTCTACAAGGAAGATAAAACATACGATTTGAACTTCAAGGAAGATAACAATGATGGCTCACAGAAGATCTCTGGAGATGCTTTGAAAGATCTATACAAGTCATTTGTGACAGAGTATCCAATTGTTTCAATTGAGGATCCTTTTGACCAGGATGACTGGGAGCACTATGCTAAGCTTACTGCTGAGGTTGGAACCAATGTACAAATTGTTGGTGATGATCTCTTGGTTACCAACCCCAAGAGGGTTCAGAAGGCAATTGATACAAAAGCATGCAATGCTCTTCTCCTTAAGGTCAACCAAATTGGTTCTGTGACTGAGAGTATTGAAGCTGTCAGGATGTCCAAAAAAGCTGGATGGGGTGTCATGGCGAGTCACAGAAGTGGAGAGACTGAGGATACCTTCATTGCTGACCTTTCTGTTGGTTTGGCAACGGGTCAAATTAAGACTGGAGCTCCATGCAGGTCAGAGCGTCTTGCTAAATATAACCAGCTCTTGAGAATTGAGGAGGAGCTTGGTGCGGAAGCAGTGTATGCTGGAGCTAACTTCCGTACCCCTGTTGAGCCCTACTAA
Predicted protein sequences of Glyma03g34830
>Glyma03g34830.1   sequence type=predicted peptide   gene model=Glyma03g34830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATIVSIKARQIFDSRGNPTVEVDLTCSDGTFARAAVPSGASTGIYEALELRDGGSDYLGKGVSKAVDNVNTIIAPALVGKDPTQQTAIDNLMVQQLDGTVNEWGWCKQKLGANAILAVSLAVCKAGAAVLKVPLYKHIANIAGNKKLVLPVPAFNVINGGSHAGNKLAMQEFMVLPVGASSFKEAMKMGVEVYHNLKSVIKKKYGQDAVNVGDEGGFAPNIQENKEGLELLKTAIAKAGYTGKVVIGMDVAASEFYKEDKTYDLNFKEDNNDGSQKISGDALKDLYKSFVTEYPIVSIEDPFDQDDWEHYAKLTAEVGTNVQIVGDDLLVTNPKRVQKAIDTKACNALLLKVNQIGSVTESIEAVRMSKKAGWGVMASHRSGETEDTFIADLSVGLATGQIKTGAPCRSERLAKYNQLLRIEEELGAEAVYAGANFRTPVEPY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo