SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g34330

Feature Type:gene_model
Chromosome:Gm03
Start:41802983
stop:41807276
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g34330
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G03530AT Annotation by Michelle Graham. TAIR10: RAB GTPase homolog C2A | chr5:885741-887061 REVERSE LENGTH=210 SoyBaseE_val: 3.00E-127ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007264GO-bp Annotation by Michelle Graham. GO Biological Process: small GTPase mediated signal transduction SoyBaseN/AISS
GO:0015031GO-bp Annotation by Michelle Graham. GO Biological Process: protein transport SoyBaseN/AISS
GO:0005777GO-cc Annotation by Michelle Graham. GO Cellular Compartment: peroxisome SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
GO:0008134GO-mf Annotation by Michelle Graham. GO Molecular Function: transcription factor binding SoyBaseN/AISS
GO:0030742GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP-dependent protein binding SoyBaseN/AISS
GO:0080115GO-mf Annotation by Michelle Graham. GO Molecular Function: myosin XI tail binding SoyBaseN/AISS
KOG0080 KOG GTPase Rab18, small G protein superfamily JGI ISS
PTHR24073Panther FAMILY NOT NAMED JGI ISS
PTHR24073:SF482Panther JGI ISS
PF00071PFAM Ras family JGI ISS
UniRef100_I1JPS2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JPS2_SOYBN SoyBaseE_val: 6.00E-149ISS
UniRef100_Q40206UniRef Annotation by Michelle Graham. Most informative UniRef hit: RAB1X n=1 Tax=Lotus japonicus RepID=Q40206_LOTJA SoyBaseE_val: 4.00E-133ISS

Expression Patterns of Glyma03g34330
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g34330
ParalogEvidenceComments
Glyma19g37020 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g34330 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g186200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g34330
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g34330
>Glyma03g34330.1   sequence type=CDS   gene model=Glyma03g34330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGTTCATCCTCAGGTCAGAGCAGTGGCTATGATCTCTCTTTCAAGATCTTGTTGATTGGAGATTCCGGGGTGGGAAAAAGTAGCCTACTTGTCAGCTTTATTTCAAGTTCTGTTGAAGATCTTTCCCCCACCATTGGTGTTGATTTTAAGATCAAAACTCTCACAGTAGGTGGCAAGAGATTGAAATTGACGATTTGGGATACTGCTGGGCAGGAAAGGTTCAGGACTCTAAACAGTTCCTACTATAGAAAAGCACAAGGAATCATTCTCGTTTATGATGTCACAAGGAGAGAAACCTTTACAAACTTATCAGAAGTGTGGTCTAAGGAAGTGGAACTCTACTCAACTAATCAGGATTGTGTGAAGATACTAGTTGGAAATAAAGTTGATAGAGATACTGAAAGGGCTGTGAGCAGAGAAGAGGGTTTAGCACTTGCTAAAGAATTGGGGTGTTTGCTTCTTGAATGTAGTGCTAAAACAAGGGAAAATGTGGAGCAGTGCTTTGAGGAACTTGCTCTAAAGATAATGGAAGCTCCTAGTCTTTTGGAAGAAGGATCAACAGCAGTTAAAAGGAGTGTTTTAAAACCAAAACAAGAATCCCAAGCATCCCAAAATGGTGGTTGTTGCTCTTAA
Predicted protein sequences of Glyma03g34330
>Glyma03g34330.1   sequence type=predicted peptide   gene model=Glyma03g34330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSSSGQSSGYDLSFKILLIGDSGVGKSSLLVSFISSSVEDLSPTIGVDFKIKTLTVGGKRLKLTIWDTAGQERFRTLNSSYYRKAQGIILVYDVTRRETFTNLSEVWSKEVELYSTNQDCVKILVGNKVDRDTERAVSREEGLALAKELGCLLLECSAKTRENVEQCFEELALKIMEAPSLLEEGSTAVKRSVLKPKQESQASQNGGCCS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo