SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g34300

Feature Type:gene_model
Chromosome:Gm03
Start:41769198
stop:41775426
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g34300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G21170AT Annotation by Michelle Graham. TAIR10: triosephosphate isomerase | chr2:9071047-9073106 REVERSE LENGTH=315 SoyBaseE_val: 5.00E-174ISS
GO:0006546GO-bp Annotation by Michelle Graham. GO Biological Process: glycine catabolic process SoyBaseN/AISS
GO:0006569GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process SoyBaseN/AISS
GO:0006642GO-bp Annotation by Michelle Graham. GO Biological Process: triglyceride mobilization SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009658GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast organization SoyBaseN/AISS
GO:0009684GO-bp Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process SoyBaseN/AISS
GO:0019253GO-bp Annotation by Michelle Graham. GO Biological Process: reductive pentose-phosphate cycle SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019563GO-bp Annotation by Michelle Graham. GO Biological Process: glycerol catabolic process SoyBaseN/AISS
GO:0032504GO-bp Annotation by Michelle Graham. GO Biological Process: multicellular organism reproduction SoyBaseN/AISS
GO:0032880GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein localization SoyBaseN/AISS
GO:0046166GO-bp Annotation by Michelle Graham. GO Biological Process: glyceraldehyde-3-phosphate biosynthetic process SoyBaseN/AISS
GO:0080022GO-bp Annotation by Michelle Graham. GO Biological Process: primary root development SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004807GO-mf Annotation by Michelle Graham. GO Molecular Function: glycolysis SoyBaseN/AISS
KOG1643 KOG Triosephosphate isomerase JGI ISS
PTHR21139Panther TRIOSEPHOSPHATE ISOMERASE JGI ISS
PF00121PFAM Triosephosphate isomerase JGI ISS
UniRef100_C6T7V6UniRef Annotation by Michelle Graham. Best UniRef hit: Triosephosphate isomerase n=1 Tax=Glycine max RepID=C6T7V6_SOYBN SoyBaseE_val: 0ISS
UniRef100_C6T7V6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Triosephosphate isomerase n=1 Tax=Glycine max RepID=C6T7V6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma03g34300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g34300
ParalogEvidenceComments
Glyma19g36990 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g34300 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g185800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g34300
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g34300
>Glyma03g34300.1   sequence type=CDS   gene model=Glyma03g34300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGCAACCTCAACATCACTGGCTTCTCAACTCTACATTGGCCTGCGCCGCCCCTGCCTCAAGCTCGATTCTTTCAATTCTCAATCTTTCTCTCTCTTCGACCCTAATCTTCGCCTATCCCTCTCTCCACCCAAACCCTCACGCGCCGTCATCGCCATGGCCGGCACCGGGAAGTTCTTTGTTGGTGGCAACTGGAAGTGTAACGGAACAAAAGACTCAATCAGCAAGCTTGTTGCTGACTTGAACAATGCAAAATTGGAGCCTGATGTTGATGTTGTCGTTGCACCTCCCTTCCTCTACATCGATCAAGTGAAAAACTCACTCACTGAGCGGATTGAAATATCTGCCCAGAATTCTTGGGTTGGAAAAGGTGGTGCTTTTACTGGAGAAATCAGCGCGGAACAACTAAAAGATCTTGGATGCAAGTGGGTTGTTCTTGGACATTCTGAGCGAAGACATGTTATTGGAGAAAATGATGAGTTTATAGGGAAGAAAGCTGCCTATGCTTTGAGCCAAGGTCTTGGGGTGATTGCATGCATTGGAGAATTGTTAGAAGAAAGGGAGGCTGGAAAAACTTTTGATGTTTGTTTTCAGCAATTGAAGGCTTATGCAGACGCAGTTGCTAGTTGGGACAACATTGTTATTGCATATGAACCTGTATGGGCCATTGGAACGGGCAAAGTGGCCACTCCCCAACAAGCTCAGGAAGTACATGTAGCTGTTCGGGATTGGCTAAAAAAGAATGTCTCAGATGAAGTTGCGTCTAAAACACGAATTATTTATGGAGGGTCTGTAAATGGAGGCAACAGTGCTGAACTGGCAAAGCAAGAAGATATTGATGGATTTCTCGTTGGAGGTGCTTCATTAAAGGGTCCTGAGTTTGCTACCATTGTCAATTCAGTCACATCCAAGAAAGTTGCGGCTTAA
Predicted protein sequences of Glyma03g34300
>Glyma03g34300.1   sequence type=predicted peptide   gene model=Glyma03g34300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAATSTSLASQLYIGLRRPCLKLDSFNSQSFSLFDPNLRLSLSPPKPSRAVIAMAGTGKFFVGGNWKCNGTKDSISKLVADLNNAKLEPDVDVVVAPPFLYIDQVKNSLTERIEISAQNSWVGKGGAFTGEISAEQLKDLGCKWVVLGHSERRHVIGENDEFIGKKAAYALSQGLGVIACIGELLEEREAGKTFDVCFQQLKAYADAVASWDNIVIAYEPVWAIGTGKVATPQQAQEVHVAVRDWLKKNVSDEVASKTRIIYGGSVNGGNSAELAKQEDIDGFLVGGASLKGPEFATIVNSVTSKKVAA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo