Glyma03g33680 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g33680

Feature Type:	gene_model
Chromosome:	Gm03
Start:	41184298
stop:	41189567
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma03g33680

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G09740	AT	Annotation by Michelle Graham. TAIR10: syntaxin of plants 71 \| chr3:2989615-2991354 FORWARD LENGTH=266	SoyBase	E_val: 2.00E-148	ISS
GO:0006605	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting	SoyBase	N/A	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0006886	GO-bp	Annotation by Michelle Graham. GO Biological Process: intracellular protein transport	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005783	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0005484	GO-mf	Annotation by Michelle Graham. GO Molecular Function: SNAP receptor activity	SoyBase	N/A	ISS
GO:0008565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein transporter activity	SoyBase	N/A	ISS
KOG3202	KOG	SNARE protein TLG1/Syntaxin 6	JGI		ISS
PTHR12380	Panther	SYNTAXIN	JGI		ISS
PTHR12380:SF24	Panther	OS05G0553700 PROTEIN	JGI		ISS
PF05739	PFAM	SNARE domain	JGI		ISS
UniRef100_B9S0N2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Syntaxin, putative n=1 Tax=Ricinus communis RepID=B9S0N2_RICCO	SoyBase	E_val: 8.00E-156	ISS
UniRef100_C6TKX1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TKX1_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma03g33680

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g33680

Paralog	Evidence	Comments
Glyma19g36410	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g33680 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.03g179500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma03g33680

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma03g33680

Limit To All Plant Sequences

>Glyma03g33680.1   sequence type=CDS   gene model=Glyma03g33680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGCGTCATCGACATTCTCACCAGAGTTGATTCCATTTGCAAAAAGTACGACAAATACGACGTCCAAAGCCAAAGGGACTCTAATCTCTCCTCCGACGATGCATTCGCCAAACTCTACGCCTCCGTCGACGCCGACATTGAGGCCTTACTTCAGAAAGCAGATACCGCTTCCAAGGAGAAAAGTAAGGCATCCACTGTGGCGATCAATGCCGAGATTCGTCGAACCAAGGCTAGGTTGTTGGAGGAGGTTCCCAAGTTGCAGAGATTGGCTATGAAAAAGGTAAAGGGGCTTTCATCACAAGAATTTGCTGCCCGTAATGATTTGGCTCTTGCATTGCCGGATAGGATTCAAGCTATCCCAGATGGGACCCCTGCAGCATCCAAACAAAGTGGAAGTTGGGCAGCTTCAGCCTCACGTCCTGGAATTAAATTTGATTCAGATGGGAAATTCGATGATGAATACTTCCAACAAACTGAAGAATCAAGTGGATTCAGGAAAGAGTACGAAATGCGTAAAATGAAACAGGATCAAGGTTTGGATATGATCGCAGAAGGATTGGATACTTTGAAAAACATGGCACATGATATGAATGAGGAACTGGATAGACAAGTTCCACTGATGGACGAGATTGATACTAAGGTGGACAGGGCATCTTCTGACCTTAAAAATACCAATGTTAGACTTAGAGATACAGTGAACCAGCTTCGATCCAGTCGAAACTTTTGTATTGATATTGTTTTGTTGATTATAATTTTGGGAATTGCTGCTTATTTGTACAACGTGCTAAAGAAATGA

Predicted protein sequences of Glyma03g33680

Limit To All Plant Sequences

>Glyma03g33680.1   sequence type=predicted peptide   gene model=Glyma03g33680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSVIDILTRVDSICKKYDKYDVQSQRDSNLSSDDAFAKLYASVDADIEALLQKADTASKEKSKASTVAINAEIRRTKARLLEEVPKLQRLAMKKVKGLSSQEFAARNDLALALPDRIQAIPDGTPAASKQSGSWAASASRPGIKFDSDGKFDDEYFQQTEESSGFRKEYEMRKMKQDQGLDMIAEGLDTLKNMAHDMNEELDRQVPLMDEIDTKVDRASSDLKNTNVRLRDTVNQLRSSRNFCIDIVLLIIILGIAAYLYNVLKK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain