Report for Sequence Feature Glyma03g33570
Feature Type: gene_model
Chromosome: Gm03
Start: 41102987
stop: 41107095
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma03g33570
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G37090 AT
Annotation by Michelle Graham. TAIR10: Nucleotide-diphospho-sugar transferases superfamily protein | chr2:15587671-15589223 REVERSE LENGTH=351
SoyBase E_val: 1.00E-148 ISS
GO:0009832 GO-bp
Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis
SoyBase N/A ISS
GO:0009834 GO-bp
Annotation by Michelle Graham. GO Biological Process: secondary cell wall biogenesis
SoyBase N/A ISS
GO:0010413 GO-bp
Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process
SoyBase N/A ISS
GO:0010417 GO-bp
Annotation by Michelle Graham. GO Biological Process: glucuronoxylan biosynthetic process
SoyBase N/A ISS
GO:0042546 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell wall biogenesis
SoyBase N/A ISS
GO:0044036 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule metabolic process
SoyBase N/A ISS
GO:0045492 GO-bp
Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process
SoyBase N/A ISS
GO:0005794 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0015018 GO-mf
Annotation by Michelle Graham. GO Molecular Function: galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity
SoyBase N/A ISS
GO:0016757 GO-mf
Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring glycosyl groups
SoyBase N/A ISS
GO:0042285 GO-mf
Annotation by Michelle Graham. GO Molecular Function: xylosyltransferase activity
SoyBase N/A ISS
KOG1476
KOG
Beta-1,3-glucuronyltransferase B3GAT1/SQV-8
JGI ISS
PTHR10896 Panther
BETA-1,3-GLUCURONYLTRANSFERASE
JGI ISS
PTHR10896:SF1 Panther
BETA-1,3-GLUCURONYLTRANSFERASE-RELATED
JGI ISS
PF03360 PFAM
Glycosyltransferase family 43
JGI ISS
UniRef100_I1JPJ7 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JPJ7_SOYBN
SoyBase E_val: 0 ISS
UniRef100_Q599J6 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Beta-3-glucuronyltransferase n=1 Tax=Medicago truncatula RepID=Q599J6_MEDTR
SoyBase E_val: 0 ISS
Expression Patterns of Glyma03g33570
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma03g33570
Paralog Evidence Comments
Glyma19g36280 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma03g33570 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.03g178300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma03g33570
Coding sequences of Glyma03g33570
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma03g33570.1 sequence type=CDS gene model=Glyma03g33570 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGGCTCACTAGAAAGATCAAAGAAGAAAGTCCTTCTATGGAAGAAGGCCATGCTCCATTTTTCTCTATGTTTTGTGATGGGGGTTTTCACAGGCTTGGCTCCAACAGGTAAATCTTCTCTCTTTTCCACCACAGTTAGTGTCTCAAATAGAACAGAATTTGCACCACAACCCAGTGAAATGTTACACCTCACAACAAATGTCAATAGAAGTTGGATAGCTCCAACCCCAGATTCCATGCCCGTGAAGCCTAGAATCCTTGAAAATGAAAAGAAAACAACAACAAAAAAGTTGCATGTAAAAGCACAGCCCCAGTTGAAGCCTAGAAGACTCCTAATCATTGTAACTCCAACAAGCACAAAACTACCCCACCAAGCAGTGTTTTTGAGAAGGTTGGCAAATACTATAAAGCTGGTTCCTCAACCATTGCTGTGGATTGTTGTGGAAGCTAAAACCAATTCCAAAGAACTGCCAGAGATACTAAGGAAAACTGGCATCATGTATAGGCATGTGGTTTTCAAGGAAAATTTCACGGAATTAGAAGCTGAACTCAATCACCAGAGGAATCTTGCGCTTAAGCACATTGAGCACCACAGGCTCAATGGCATTGTACACTTTGCTGGCCTTTCCAATGTTTATGATCTCCAATTCTTCCATCAGCTTAGAGATATTGAGGTCTTTGGAACATGGCCAACAGCTTTGTTAGCTGCACACAGGAAGAAAGTGAAAATCGAAGGACCTGTATGTGATTCATCACAAGTCATTGGTTGGCATCTTAAGAATATGAACAATGAAACTGATACTATCACTCCCCCAATTCATATTTCAAGTTTTGCTTTTAATAGCTCCATCCTTTGGGACTCTGAGAGATGGGGTCGCACTTCCTCTGTTCAAGACACTTCTCAGAATTCGATCAAGTTCGTGAAACAAGTAGTTCTAGAGGATGAGGCTAAATTAAAGGGAATTCCACCAGAGGATTGCTCCAAAATCTTGCTCTGGCGTTTCAATTTTCGTGCCAGAACTCATTAA
Predicted protein sequences of Glyma03g33570
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma03g33570.1 sequence type=predicted peptide gene model=Glyma03g33570 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MGSLERSKKKVLLWKKAMLHFSLCFVMGVFTGLAPTGKSSLFSTTVSVSNRTEFAPQPSEMLHLTTNVNRSWIAPTPDSMPVKPRILENEKKTTTKKLHVKAQPQLKPRRLLIIVTPTSTKLPHQAVFLRRLANTIKLVPQPLLWIVVEAKTNSKELPEILRKTGIMYRHVVFKENFTELEAELNHQRNLALKHIEHHRLNGIVHFAGLSNVYDLQFFHQLRDIEVFGTWPTALLAAHRKKVKIEGPVCDSSQVIGWHLKNMNNETDTITPPIHISSFAFNSSILWDSERWGRTSSVQDTSQNSIKFVKQVVLEDEAKLKGIPPEDCSKILLWRFNFRARTH*