Glyma03g31860 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g31860): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g31860): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g31860

Feature Type:	gene_model
Chromosome:	Gm03
Start:	39674384
stop:	39675647
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma03g31860

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G58190	AT	Annotation by Michelle Graham. TAIR10: lateral organ boundaries-domain 29 \| chr3:21548716-21549488 REVERSE LENGTH=218	SoyBase	E_val: 1.00E-66	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0009741	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to brassinosteroid stimulus	SoyBase	N/A	ISS
GO:0010311	GO-bp	Annotation by Michelle Graham. GO Biological Process: lateral root formation	SoyBase	N/A	ISS
GO:0010583	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
PF03195	PFAM	Protein of unknown function DUF260	JGI		ISS
UniRef100_B9T847	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: LOB domain-containing protein, putative n=1 Tax=Ricinus communis RepID=B9T847_RICCO	SoyBase	E_val: 8.00E-96	ISS
UniRef100_I1JP23	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JP23_SOYBN	SoyBase	E_val: 2.00E-157	ISS

Expression Patterns of Glyma03g31860

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g31860 not represented in the dataset	Glyma03g31860 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g31860

Paralog	Evidence	Comments
Glyma19g34600	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g31860 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.03g161500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma03g31860

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma03g31860

Limit To All Plant Sequences

>Glyma03g31860.1   sequence type=CDS   gene model=Glyma03g31860   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACTGGTTCTGGTTCTCCTTGTGGAGCCTGCAAGTTCTTGAGAAGGAAGTGTGTGAGAGGTTGTGTTTTTGCACCTTACTTTTGCCATGAACAGGGTGTTACCCATTTTGCAGCCATTCATAAGGTCTTTGGTGCAAGCAATGTCTCAAAGCTCCTTGCTCACCTCCCTGTGAGTGACCGTTGCGAAGCCACAGTCACAATCTCTTATGAAGCTCAAGCTAGACTTCAGGATCCAATTTATGGCTGTGTTGCTCATATTTTTGCACTTCAAGAACAGGTGGTGAATTTACAAGCTCAGCTAGCTTATCTCAGGGAACAAGCAGGTCAGATCTATCTGAATGCCTCTGCCACTGAAAACCCTAATGAGAAACTCCTTGGAAAACCTACTACTTTCCCTCAAGATCTTCAAAGTCGGTTCCAAATGGAAAATTCCAACATGGCTTCACAATTTCTCCCTAACTTGTCCACCAATCCCTCAACACACTATTATGGGAACACTAATAGTCTCATGGAGCCAAACCCTATTGGAAATTATGAAAGTTCAGGAACCGTAGAAGAAAGCATCTCATTTTCTAGCTTTGAAGAGAGTTGTAACTCAATGTCCTATGACATGCAAAGGCAGTGGGGCCTTTCATGA

Predicted protein sequences of Glyma03g31860

Limit To All Plant Sequences

>Glyma03g31860.1   sequence type=predicted peptide   gene model=Glyma03g31860   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTGSGSPCGACKFLRRKCVRGCVFAPYFCHEQGVTHFAAIHKVFGASNVSKLLAHLPVSDRCEATVTISYEAQARLQDPIYGCVAHIFALQEQVVNLQAQLAYLREQAGQIYLNASATENPNEKLLGKPTTFPQDLQSRFQMENSNMASQFLPNLSTNPSTHYYGNTNSLMEPNPIGNYESSGTVEESISFSSFEESCNSMSYDMQRQWGLS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain