SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g31545

Feature Type:gene_model
Chromosome:Gm03
Start:39428850
stop:39436165
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g31545
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G03030AT Annotation by Michelle Graham. TAIR10: P-loop containing nucleoside triphosphate hydrolases superfamily protein | chr1:701621-703568 FORWARD LENGTH=301 SoyBaseE_val: 1.00E-102ISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009058GO-bp Annotation by Michelle Graham. GO Biological Process: biosynthetic process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0016773GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphotransferase activity, alcohol group as acceptor SoyBaseN/AISS
PTHR10285Panther URIDINE KINASE RELATED JGI ISS
PTHR10285:SF29Panther PHOSPHORIBULOKINASE JGI ISS
PF00485PFAM Phosphoribulokinase / Uridine kinase family JGI ISS
UniRef100_B9S4S4UniRef Annotation by Michelle Graham. Most informative UniRef hit: ATP binding protein, putative n=1 Tax=Ricinus communis RepID=B9S4S4_RICCO SoyBaseE_val: 3.00E-110ISS
UniRef100_I1N9M3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1N9M3_SOYBN SoyBaseE_val: 3.00E-137ISS

Expression Patterns of Glyma03g31545
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g31545 not represented in the dataset
Glyma03g31545 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g31545
ParalogEvidenceComments
Glyma19g34390 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g31545 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g158800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g31545
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g31545
>Glyma03g31545.1   sequence type=CDS   gene model=Glyma03g31545   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CGTGTTGATGAGTTATATGATACATTGGTTACACGTCTTCTGCCTTCAGTGTCAGTGTCATCAAATCCTAATCACAAGCTTTTAGTTGGGCTGGCTGGTCCTCCTGGTGCTGGAAAAAGCACTCTAGCACATGAAGTAGCCAGACGTATAAACAAACTTTGGCCAGAGAAAGCTTCTTCCTTTGACTCTCTGGTTGAACCTCCAGATGTTGCTATTGTGGTTCCCATGGATGGTTTTCATCTTTATCGTTTTGAACTAGACGCAATGGAGAATCTCGAGGAAGCACATGCCAGAAGGGGAGCTCCCTGGACATTCAATCCATTGGGACTACTTACATATCTCAAGAATCTGAGAAGTCATGGATCAGTTTATGTACCATCATTTGACCATGGTGTTGGGGACCCAGTTAAGATGCTCAAGGTTGTTATTGTAGAAGGTAACTATTTGCTCTTGGAAGATGGGCAATGGAAGGAGATATCTTCTTTGTTTGACGAGAAATGGCAAGCATTGATTTTACCAAGGCATATGTATATTGATATTGACATTGACGAAGCAATGCAGCGAGTTTTAAAGAGGCATATTTCAACTGGCAAGCCTCCAGACATTGCTAAACAGCGGATGGAGAACAACGACAGTCTTAATGCAGAACTTATAATGAAGTCCAAGAAAAATGCTGATATAATAATCGAGTCAGTTGATTTCTGA
Predicted protein sequences of Glyma03g31545
>Glyma03g31545.1   sequence type=predicted peptide   gene model=Glyma03g31545   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
RVDELYDTLVTRLLPSVSVSSNPNHKLLVGLAGPPGAGKSTLAHEVARRINKLWPEKASSFDSLVEPPDVAIVVPMDGFHLYRFELDAMENLEEAHARRGAPWTFNPLGLLTYLKNLRSHGSVYVPSFDHGVGDPVKMLKVVIVEGNYLLLEDGQWKEISSLFDEKWQALILPRHMYIDIDIDEAMQRVLKRHISTGKPPDIAKQRMENNDSLNAELIMKSKKNADIIIESVDF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo