Glyma03g30080 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g30080): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g30080): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g30080

Feature Type:	gene_model
Chromosome:	Gm03
Start:	38048104
stop:	38055540
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma03g30080

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G42120	AT	Annotation by Michelle Graham. TAIR10: DNA polymerase delta small subunit \| chr2:17563282-17565965 REVERSE LENGTH=440	SoyBase	E_val: 0	ISS
GO:0006260	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA replication	SoyBase	N/A	ISS
GO:0006261	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA-dependent DNA replication	SoyBase	N/A	ISS
GO:0006306	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA methylation	SoyBase	N/A	ISS
GO:0006346	GO-bp	Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing	SoyBase	N/A	ISS
GO:0007020	GO-bp	Annotation by Michelle Graham. GO Biological Process: microtubule nucleation	SoyBase	N/A	ISS
GO:0008283	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell proliferation	SoyBase	N/A	ISS
GO:0009560	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation	SoyBase	N/A	ISS
GO:0009909	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of flower development	SoyBase	N/A	ISS
GO:0016458	GO-bp	Annotation by Michelle Graham. GO Biological Process: gene silencing	SoyBase	N/A	ISS
GO:0016570	GO-bp	Annotation by Michelle Graham. GO Biological Process: histone modification	SoyBase	N/A	ISS
GO:0031047	GO-bp	Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA	SoyBase	N/A	ISS
GO:0031048	GO-bp	Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA	SoyBase	N/A	ISS
GO:0034968	GO-bp	Annotation by Michelle Graham. GO Biological Process: histone lysine methylation	SoyBase	N/A	ISS
GO:0048449	GO-bp	Annotation by Michelle Graham. GO Biological Process: floral organ formation	SoyBase	N/A	ISS
GO:0051567	GO-bp	Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003887	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA-directed DNA polymerase activity	SoyBase	N/A	ISS
KOG2732	KOG	DNA polymerase delta, regulatory subunit 55	JGI		ISS
PTHR10416	Panther	DNA POLYMERASE DELTA SMALL SUBUNIT	JGI		ISS
PF04042	PFAM	DNA polymerase alpha/epsilon subunit B	JGI		ISS
UniRef100_G7KVD6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: DNA polymerase delta small subunit n=1 Tax=Medicago truncatula RepID=G7KVD6_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1JNK6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JNK6_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma03g30080

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g30080 not represented in the dataset	Glyma03g30080 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g30080

Paralog	Evidence	Comments
Glyma19g32950	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g30080 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.03g144600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma03g30080

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma03g30080

Limit To All Plant Sequences

>Glyma03g30080.1   sequence type=CDS   gene model=Glyma03g30080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAATGGAGCGAGTGCAGTGTGCCTATGCCTCTCTGGACGAAGCGTTCGAAATAGGGAAAGAGGCGTATCAGGGGCAGCAGTACAGCCAGATTTACTTCGCGCGCCTTCATTTGATGCGAACACTTTTATATTCCCTCGTTCCTCATTGGAAACCCAATTTTCCCGTGTGCACAGTGCTGGGATTGGAAGAGGGGAAGGAGTGTGTCATTGTTGGAACCCTCTATAAACACATGAAGCTCAAACCTTGCATTCTTGATGAGTATTCCAAGGAGAGATCAGTGGTTCCACTTGTCAAGCCACATAACTTCATACACCCGGATGATCACCTAGTTTTGGAAGATGAAAGCGGGCGGGTTAAGCTCAGTGGGAGTATCATTTTGCCATCTGAATATGTAACAGGAATTGTGGTTGCTTTACTTGGAAAGGAAACGGGGGCAGGTGACTTTTTGGTTCAGGATGTCCTGGATGCTGGCTTACCACCACAGATAGAATTCCCCCTTAAACCAAGGGAAGACAAGTATGTTGTTCTTGTGTCAGGGTTAAGTGTTGGGAGCAGCAGCTCTAATCCTCTTCAGTTTCAGCTTCTCATTGATCATATTACAGGGCATTTAGGAGATGAGAAGGAGCAAAGTATCGCATCACAAATTGTTCGAGTTGTCTTTGCTGGAAATTTAGTCGAGATACCTCGCAGACTTCTTAATGGACAGAATTTGGCGTCTAAGGATCTCTCAAGGATGGCTGAGCCAATAAAGGAGCTAGATATTCTGTTGAGTCAGATAGCTGCTGGCTTGCCTTTGGATATCATGCCAGGACCCAGTGACCCTGCTAATTTCTCACTACCACAGCAGTCATTGCATAGATGCCTTTTCCCTGGGTCATCGGCATATAATACTTTTAGATCTTGTACAAATCCTCATTGTTTTGAGGTTGATAATGTCAGATTTCTTGGGACATCGGGTCAAAATGTAGATGATCTTGAGAAGTATTCAGAGGCAAAAGATAAACTTGAATTCATGGAAAGGACATTAAGATGGAGGCATTTGGCACCCACTGCTCCTAATACTCTTGGATGCTATCCTTATACTGATAAGGATCCTTTCTTCATTGAGAGCTGTCCTCATGTTTACTTTGTTGGAAATCAAGATAAATTTGAAACTCGTGTCATAAAGGGATCAGAAGGGCAGTTGGTGAGACTCATATGTGTTCCTAAATTCAGTGAAACTGGAGTTGCTGTTATGCTAAATCTGAGGGACCTTGATTGTCATGCTCTCAGTTTTGGAACGCAATTCAGCTCATAA

Predicted protein sequences of Glyma03g30080

Limit To All Plant Sequences

>Glyma03g30080.1   sequence type=predicted peptide   gene model=Glyma03g30080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGMERVQCAYASLDEAFEIGKEAYQGQQYSQIYFARLHLMRTLLYSLVPHWKPNFPVCTVLGLEEGKECVIVGTLYKHMKLKPCILDEYSKERSVVPLVKPHNFIHPDDHLVLEDESGRVKLSGSIILPSEYVTGIVVALLGKETGAGDFLVQDVLDAGLPPQIEFPLKPREDKYVVLVSGLSVGSSSSNPLQFQLLIDHITGHLGDEKEQSIASQIVRVVFAGNLVEIPRRLLNGQNLASKDLSRMAEPIKELDILLSQIAAGLPLDIMPGPSDPANFSLPQQSLHRCLFPGSSAYNTFRSCTNPHCFEVDNVRFLGTSGQNVDDLEKYSEAKDKLEFMERTLRWRHLAPTAPNTLGCYPYTDKDPFFIESCPHVYFVGNQDKFETRVIKGSEGQLVRLICVPKFSETGVAVMLNLRDLDCHALSFGTQFSS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain